Skip to Content
Merck
All Photos(1)

Documents

EMU071351

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Src

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACGAGGAAGGTGGATGTCAGAGAGGGAGACTGGTGGCTGGCACACTCGCTGAGCACGGGACAGACCGGTTACATCCCCAGCAACTATGTGGCGCCCTCCGACTCCATCCAGGCTGAGGAGTGGTACTTTGGCAAGATCACTAGACGGGAATCAGAGCGGCTGCTGCTCAACGCCGAGAACCCGAGAGGGACCTTCCTCGTGAGGGAGAGTGAGACCACAAAAGGTGCCTACTGCCTCTCTGTATCCGACTTCGACAATGCCAAGGGCCTAAATGTGAAACACTACAAGATCCGCAAGCTGGACAGCGGCGGTTTCTACATCACCTCCCGCACCCAGTTCAACAGCCTGCAGCAGCTCGTGGCTTACTACTCCAAACATGCTGATGGCCTGTGTCACCGCCTCACTACCGTATGTCCCACATCCAAGCCT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiaohua Guo et al.
PloS one, 15(4), e0231739-e0231739 (2020-05-01)
We previously reported microvascular leakage resulting from fibrinogen-γ chain C-terminal products (γC) occurred via a RhoA-dependent mechanism. The objective of this study was to further elucidate the signaling mechanism by which γC induces endothelial hyperpermeability. Since it is known that
Nan Wang et al.
PloS one, 9(8), e105570-e105570 (2014-08-21)
SRC, also known as proto-oncogene c-Src, is a non-receptor tyrosine kinase that plays an important role in cancer progression by promoting survival, angiogenesis, proliferation, and invasion pathways. In this study, we found that SRC protein levels were consistently upregulated in
M Katie Conley-LaComb et al.
Molecular cancer, 15(1), 68-68 (2016-11-05)
The CXCL12/CXCR4 axis transactivates HER2 and promotes intraosseous tumor growth. To further explore the transactivation of HER2 by CXCL12, we investigated the role of small GTP protein G We used a variety of methods such as lipid raft isolation, invasion
Jun Wang et al.
Oncotarget, 8(48), 83872-83889 (2017-11-16)
Src has been reported to mediate tissue fibrosis in several organs, but its role in peritoneal fibrosis remains unknown. In this study, we evaluated the therapeutic effect of KX2-391, a highly selective inhibitor of Src, on the development of peritoneal
Wei Liu et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 32(6), 3033-3046 (2018-02-07)
Hepatitis B virus core protein (HBc) is expressed preferentially in hepatitis B virus (HBV)-associated hepatocellular carcinoma (HCC). HBc can function as an oncogene arising from its gene regulatory properties, but how it contributes functionally to hepatocarcinogenesis remains unclear. In this

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service