Skip to Content
Merck
All Photos(1)

Documents

EMU026301

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nr1h4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGTGGAGGCCATGTTTCTTCGTTCGGCGGAGATTTTCAATAAGAAACTTCCTGCCGGACATGCAGACCTGTTGGAAGAAAGAATTCGAAAGAGTGGTATCTCTGATGAGTATATAACCCCGATGTTCAGTTTCTATAAAAGTGTTGGAGAACTCAAAATGACTCAGGAGGAGTACGCTCTGCTCACAGCGATCGTCATCCTCTCTCCAGACAGACAATACATCAAGGACAGAGAGGCGGTGGAGAAGCTGCAGGAGCCCCTGCTTGATGTGCTACAAAAGCTGTGCAAGATGTACCAGCCTGAGAACCCACAGCATTTCGCCTGCCTCCTGGGTCGCCTGACGGAACTCCGGACATTCAACCATCACCACGCTGAGATGCTGATGTCTTGGAGAGTGAATGATCACAAGTTCACCCCGCTCCTCTGTGAGATCTGGGATGTGCAGTGATGGACAC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tomofumi Fujino et al.
The Journal of toxicological sciences, 40(4), 501-508 (2015-07-15)
Identification of substances with specific toxicity for carcinoma cells promises to facilitate the development of cancer chemotherapeutics that cause minimal side effects. Here, we show that knockdown of the farnesoid X receptor (FXR) effectively suppresses the proliferation of human hepatocellular
Jialin He et al.
Molecular cancer, 14, 163-163 (2015-08-26)
microRNA-122 (miR-122) is the most abundant and specific miRNA in the liver. It acts as an important tumor suppressor in hepatocellular carcinoma (HCC) through regulating its target genes, but details of its own regulation are largely unknown. Farnesoid X receptor
Yan-Dong Wang et al.
Molecular endocrinology (Baltimore, Md.), 29(2), 322-331 (2014-12-17)
The farnesoid X receptor (FXR) is a key metabolic and homeostatic regulator in the liver. In the present work, we identify a novel role of FXR in antagonizing c-Jun N-terminal kinase (JNK) signaling pathway in liver carcinogenesis by activating superoxide

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service