Skip to Content
Merck
All Photos(1)

Documents

EHU156661

Sigma-Aldrich

MISSION® esiRNA

targeting human NFE2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AATGCTCCAAGTGAGCCATCATTTGAGCCCCAAGCCCCAGCTCCATACCTTGGACCTCCACCACCCACAACTTACTGCCCCTGCTCAATCCACCCAGATTCTGGCTTCCCACTTCCTCCACCACCTTATGAGCTCCCAGCATCCACATCCCATGTCCCAGATCCCCCATACTCCTATGGCAACATGGCCATACCAGTCTCCAAGCCACTGAGCCTCTCAGGCCTGCTCAGTGAGCCGCTCCAAGACCCCTTAGCCCTCCTGGACATTGGGCTGCCAGCAGGGCCACCTAAGCCCCAAGAAGACCCAGAATCCGACTCAGGATTATCCCTCAACTATAGCGATGCTGAATCTCTTGAGCTGGAGGGGACAGAGGCTGGTCGGCGGCGCAGCGAATATGTAGAGATGTACCCAGTGGAGTACCCCTACTCACTCATGCCCAACTCC

Ensembl | human accession no.

ENSG00000123405

NCBI accession no.

NM_001136023

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NFE2(4778) , NFE2(4778)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shunying Jin et al.
Life sciences, 254, 117783-117783 (2020-05-16)
This study aimed to examine the anti-fibrotic role of Nuclear Factor-Erythroid derived 2 (NF-E2) in human renal tubule (HK-11) cells and in type 1 and type 2 diabetic (T1D, T2D) mouse kidneys. Anti-fibrotic effects of NF-E2 were examined in transforming
Haijin Chen et al.
Molecular medicine reports, 10(2), 1129-1135 (2014-06-11)
Colon cancer is a common type of malignancy in the digestive system. The aim of the present study was to investigate the role of S-phase kinase-associated protein 2 (Skp2) in colon carcinoma and to identify whether depletion of Skp2 by Skp2‑RNA interference
Ming Qi et al.
Molecular medicine reports, 11(5), 3934-3940 (2015-01-13)
In order to determine the protein expression of S‑phase kinase‑associated protein 2 (Skp2) and p27kip1, and to evaluate their possible prognostic values in malignant liver cancer, tissue samples from 50 patients and 40 controls were assessed and analyzed by immunohistochemistry
Zhe Sha et al.
The Journal of cell biology, 217(5), 1757-1776 (2018-03-15)
Proteasome inhibitors are used as research tools and to treat multiple myeloma, and proteasome activity is diminished in several neurodegenerative diseases. We therefore studied how cells compensate for proteasome inhibition. In 4 h, proteasome inhibitor treatment caused dramatic and selective

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service