Skip to Content
Merck
All Photos(1)

Key Documents

EHU123931

Sigma-Aldrich

MISSION® esiRNA

targeting human NUDT1

Sign Into View Organizational & Contract Pricing

Select a Size


Select a Size

Change View

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAAGAAGGAGAGACCATCGAGGATGGGGCTAGGAGGGAGCTGCAGGAGGAGAGCGGTCTGACAGTGGACGCCCTGCACAAGGTGGGCCAGATCGTGTTTGAGTTCGTGGGCGAGCCTGAGCTCATGGACGTGCATGTCTTCTGCACAGACAGCATCCAGGGGACCCCCGTGGAGAGCGACGAAATGCGCCCATGCTGGTTCCAGCTGGATCAGATCCCCTTCAAGGACATGTGGCCCGACGACAGCTACTGGTTTCCACTCCTGCTTCAGAAGAAGAAATTCCACGGGTACTTCAAGTTCCAGGGTCAGGACACCATCCTGGACTACACACTCCGCGAGGTGGACACGGTCTAGCGGGAGCCCAGGGCAGCCCCTGGGCAGGAGACGTGGCTGCTGAACAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhen Chen et al.
Cancer cell international, 20, 337-337 (2020-07-28)
Glioblastoma multiforme (GBM) is the most common and lethal type of primary brain tumor. More than half of GBMs contain mutation(s) of PTEN/PI3K/AKT, making inhibitors targeting the PI3K pathway very attractive for clinical investigation. However, so far, PI3K/AKT/mTOR inhibitors have
Ya Gao et al.
Oncotarget, 8(56), 95865-95879 (2017-12-10)
Cancer cells are more addictive to MTH1 than normal cells because of their dysfunctional redox regulations. MTH1 plays an important role to maintain tumor cell survival, while it is not indispensable for the growth of normal cells. Farnesyl phenols having
Bharathan Bhavya et al.
Life sciences, 264, 118673-118673 (2020-11-02)
The study focused on the expression and role of a recent potential cancer therapeutic target protein, MutT Homolog1 (MTH1). MTH1 gets activated in an increased reactive oxygen species (ROS) environment and removes the oxidized nucleotides from the cell. The study

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service