Skip to Content
Merck
All Photos(1)

Key Documents

EHU121191

Sigma-Aldrich

MISSION® esiRNA

targeting human DES

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGCTGCAGGAGGAGATTCAGTTGAAGGAAGAAGCAGAGAACAATTTGGCTGCCTTCCGAGCGGACGTGGATGCAGCTACTCTAGCTCGCATTGACCTGGAGCGCAGAATTGAATCTCTCAACGAGGAGATCGCGTTCCTTAAGAAAGTGCATGAAGAGGAGATCCGTGAGTTGCAGGCTCAGCTTCAGGAACAGCAGGTCCAGGTGGAGATGGACATGTCTAAGCCAGACCTCACTGCCGCCCTCAGGGACATCCGGGCTCAGTATGAGACCATCGCGGCTAAGAACATTTCTGAAGCTGAGGAGTGGTACAAGTCGAAGGTGTCAGACCTGACCCAGGCAGCCAACAAGAACAACGACGCCCTGCGCCAGGCCAAGCAGGAGATGATGGAATACCGACACCAGATCCAGTCCTACACCTGCGAGATTGACGCCCTGAAGGGCACTAACGATTCCCTGATGAGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ji Hyun Kim et al.
Anatomy & cell biology, 46(4), 272-284 (2014-01-05)
Carbonic anhydrase type IX (CA9) is known to express in the fetal joint cartilage to maintain pH against hypoxia. Using paraffin-embedded histology of 10 human fetuses at 10-16 weeks of gestation with an aid of immunohistochemistry of the intermediate filaments
Monica Gunetti et al.
PloS one, 7(9), e45538-e45538 (2012-10-03)
Urinary incontinence, defined as the complaint of any involuntary loss of urine, is a pathological condition, which affects 30% females and 15% males over 60, often following a progressive decrease of rhabdosphincter cells due to increasing age or secondary to
Nobuyuki Hinata et al.
BioMed research international, 2014, 906921-906921 (2014-05-31)
Detailed knowledge of the anatomy of the rhabdosphincter and adjacent tissues is mandatory during urologic surgery to ensure reliable oncologic and functional outcomes. To characterize the levator ani (LA) function for the urethral sphincter, we described connective tissue morphology between
Yusuke Kinugasa et al.
Yonsei medical journal, 53(4), 849-855 (2012-06-06)
We recently demonstrated the morphology of the anococcygeal ligament. As the anococcygeal ligament and raphe are often confused, the concept of the anococcygeal raphe needs to be re-examined from the perspective of fetal development, as well as in terms of
Tomoyuki Ikeda et al.
Journal of cardiovascular pharmacology, 66(5), 487-496 (2015-08-08)
The effects of chronic blockade of vasopressin type 1a receptors (V1aR) and the additive effects of a type 2 receptor (V2R) antagonist on the treatment of hypertension-induced heart failure and renal injury remain to be unknown. In this study, Dahl

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service