Skip to Content
Merck
All Photos(1)

Documents

EHU113961

Sigma-Aldrich

MISSION® esiRNA

targeting human PARK7

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTGAAGGAGCAGGAAAACCGGAAGGGCCTGATAGCCGCCATCTGTGCAGGTCCTACTGCTCTGTTGGCTCATGAAATAGGTTTTGGAAGTAAAGTTACAACACACCCTCTTGCTAAAGACAAAATGATGAATGGAGGTCATTACACCTACTCTGAGAATCGTGTGGAAAAAGACGGCCTGATTCTTACAAGCCGGGGGCCTGGGACCAGCTTCGAGTTTGCGCTTGCAATTGTTGAAGCCCTGAATGGCAAGGAGGTGGCGGCTCAAGTGAAGGCTCCACTTGTTCTTAAAGACTAGAGCAGCGAACTGCGACGATCACTTAGAGAAACAGGCCGTTAGGAATCCATTCTCACTGTGTTCGCTCTAAACAAAACAGTGGTAGGTTAATGTGTTCAGAAGTCGCTGTCCTT

Ensembl | human accession no.

ENSG00000116288

NCBI accession no.

NM_007262

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PARK7(11315) , PARK7(11315)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Prahlad V Raninga et al.
Apoptosis : an international journal on programmed cell death, 21(12), 1422-1437 (2016-10-28)
Multiple myeloma (MM) is an incurable plasma B cell malignancy. Despite recent advancements in anti-MM therapies, development of drug resistance remains a major clinical hurdle. DJ-1, a Parkinson's disease-associated protein, is upregulated in many cancers and its knockdown suppresses tumor
Bijun Qiu et al.
Oncotarget, 8(5), 8499-8511 (2016-12-31)
Chronic liver inflammation and injuries play a critical role in development of hepatocellular carcinoma (HCC). Parkinson disease (autosomal recessive, early onset) 7, encoding PARK7 protein (also called DJ-1), plays important roles in many carcinogenesis processes and is essential in modulating
Seongmi Lee et al.
The Korean journal of physiology & pharmacology : official journal of the Korean Physiological Society and the Korean Society of Pharmacology, 21(6), 625-632 (2017-12-05)
Familial Parkinson's disease (PD) has been linked to point mutations and duplication of the α-synuclein (α-syn) gene. Mutant α-syn expression increases the vulnerability of neurons to exogenous insults. In this study, we developed a new PD model in the transgenic
Nathaniel Edward Bennett Saidu et al.
Molecular cancer therapeutics, 16(3), 529-539 (2017-01-11)
The transcription factor NRF2 (NFE2L2), regulates important antioxidant and cytoprotective genes. It enhances cancer cell proliferation and promotes chemoresistance in several cancers. Dimethyl fumarate (DMF) is known to promote NRF2 activity in noncancer models. We combined
Chih-Ru Lin et al.
American journal of physiology. Lung cellular and molecular physiology, 317(6), L791-L804 (2019-07-18)
Pulmonary emphysema is characterized by alveolar type II (ATII) cell death, destruction of alveolar wall septa, and irreversible airflow limitation. Cigarette smoke induces oxidative stress and is the main risk factor for this disease development. ATII cells isolated from nonsmokers
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service