Skip to Content
Merck
All Photos(1)

Key Documents

EHU107331

Sigma-Aldrich

MISSION® esiRNA

targeting human PSMC3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTGACTCGGCAGGAGAAGATGGCGACCGTGTGGGATGAGGCCGAGCAAGATGGAATTGGGGAGGAGGTGCTCAAGATGTCCACGGAGGAGATCATCCAGCGCACACGGCTGCTGGACAGTGAGATCAAGATCATGAAGAGTGAAGTGTTGAGAGTCACCCATGAGCTCCAAGCCATGAAGGACAAGATAAAAGAGAACAGTGAGAAAATCAAAGTGAACAAGACCCTGCCGTACCTTGTCTCCAACGTCATCGAGCTCCTGGATGTTGATCCTAATGACCAAGAGGAGGATGGTGCCAATATTGACCTGGACTCCCAGAGGAAGGGCAAGTGTGCTGTGATCAAAACCTCTACACGACAGACGTACTTCCTTCCTGTGATTGGGTTGGTGGATGCTGAAAAGCTAAAGCCAGGAGACCTGGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

J-S Dong et al.
European review for medical and pharmacological sciences, 24(5), 2264-2270 (2020-03-21)
The importance of circular RNAs in malignant tumors has attracted a lot of attention. Circular PSMC3 (CircPSMC3) is identified as a tumor suppressor in gastric cancer. The role of circPSMC3 in prostate cancer (PCa) remains unclear. Our study aims to
Maria Anania et al.
Oncotarget, 6(33), 34629-34648 (2015-10-03)
The incidence of thyroid carcinoma is rapidly increasing. Although generally associated with good prognosis, a fraction of thyroid tumors are not cured by standard therapy and progress to aggressive forms for which no effective treatments are currently available. In order

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service