Skip to Content
Merck
All Photos(1)

Key Documents

EHU100991

Sigma-Aldrich

MISSION® esiRNA

targeting human L1CAM

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCCTTGGGAGAAGAGAAGGGTGGGGCTTCCCTTTCGCCACAGTATGTCAGCTACAACCAGAGCTCCTACACGCAGTGGGACCTGCAGCCTGACACTGACTACGAGATCCACTTGTTTAAGGAGAGGATGTTCCGGCACCAAATGGCTGTGAAGACCAATGGCACAGGCCGCGTGAGGCTCCCTCCTGCTGGCTTCGCCACTGAGGGCTGGTTCATCGGCTTTGTGAGTGCCATCATCCTCCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jin-Cheng Guo et al.
Journal of molecular medicine (Berlin, Germany), 95(12), 1355-1368 (2017-09-25)
L1 cell adhesion molecule (L1CAM) is highly expressed in various types of human cancers, displaying yet unknown molecular mechanisms underlying their oncogenic potential. Here, we found that L1CAM expression was significantly increased in esophageal squamous cell carcinoma (ESCC; n = 157) lesions
Chaohui Zuo et al.
Pancreatology : official journal of the International Association of Pancreatology (IAP) ... [et al.], 18(3), 328-333 (2018-03-12)
To explore the molecular mechanisms of celecoxib-induced pancreatic cancer suppression in vivo and in vitro. The anti-pancreatic cancer activities of celecoxib (0, 20, 60 and 100 μmol/L) were investigated by cell viability and migration of Panc-1 and Bxpc-3 cells in vitro. The expression of L1CAM

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service