Skip to Content
Merck
All Photos(1)

Documents

EHU092501

Sigma-Aldrich

MISSION® esiRNA

targeting human TRAF3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACATGGACCTGCGCTTCCAGGTCCTGGAGACCGCCAGCTACAATGGAGTGCTCATCTGGAAGATTCGCGACTACAAGCGGCGGAAGCAGGAGGCCGTCATGGGGAAGACCCTGTCCCTTTACAGCCAGCCTTTCTACACTGGTTACTTTGGCTATAAGATGTGTGCCAGGGTCTACCTGAACGGGGACGGGATGGGGAAGGGGACGCACTTGTCGCTGTTTTTTGTCATCATGCGTGGAGAATATGATGCCCTGCTTCCTTGGCCGTTTAAGCAGAAAGTGACACTCATGCTGATGGATCAGGGGTCCTCTCGACGTCATTTGGGAGATGCATTCAAGCCCGACCCCAACAGCAGCAGCTTCAAGAAGCCCACTGGAGAGATGAATATCGCCTCTGGCTGCCCAGTCTTTGTGGCCCAAACTGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Liping Sun et al.
IUBMB life, 69(3), 170-178 (2017-02-12)
This study aims to investigate the effects of TNF receptors associated factor 3 (TRAF3) on the signaling pathway and expression of downstream products of nuclear factor kappa B (NF-κB) in the epithelial cells of renal ducts in individuals with polycystic
Hongzhi Sun et al.
International immunopharmacology, 88, 106691-106691 (2020-08-22)
Acute pancreatitis (AP) is an inflammatory disease with high morbidity and mortality. Dysregulation of microRNAs (miRNAs) was involved in human diseases, including AP. However, the effects of miR-92b-3p on AP process and its mechanism remain not been fully clarified. The
Shengtao Yao et al.
Neuropsychiatric disease and treatment, 12, 3083-3092 (2016-12-17)
Ischemic stroke is one of the leading causes of brain disease, with high morbidity, disability, and mortality. MicroRNAs (miRNAs) have been identified as vital gene regulators in various types of human diseases. Accumulating evidence has suggested that aberrant expression of
Jin Liu et al.
Scientific reports, 7, 40487-40487 (2017-01-11)
The role of osteoclastic miRNAs in regulating osteolytic bone metastasis (OBM) of breast cancer is still underexplored. Here, we examined the expression profiles of osteoclastogenic miRNAs in human bone specimens and identified that miR-214-3p was significantly upregulated in breast cancer
Yanyan Peng et al.
PLoS pathogens, 10(4), e1004041-e1004041 (2014-04-26)
RIG-I like receptors (RLRs) recognize cytosolic viral RNA and initiate innate immunity; they increase the production of type I interferon (IFN) and the transcription of a series of antiviral genes to protect the host organism. Accurate regulation of the RLR

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service