Skip to Content
Merck
All Photos(1)

Documents

EHU078971

Sigma-Aldrich

MISSION® esiRNA

targeting human TFRC

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCCAGCAAAGTTGAGAAACTCACTTTAGACAATGCTGCTTTCCCTTTCCTTGCATATTCTGGAATCCCAGCAGTTTCTTTCTGTTTTTGCGAGGACACAGATTATCCTTATTTGGGTACCACCATGGACACCTATAAGGAACTGATTGAGAGGATTCCTGAGTTGAACAAAGTGGCACGAGCAGCTGCAGAGGTCGCTGGTCAGTTCGTGATTAAACTAACCCATGATGTTGAATTGAACCTGGACTATGAGAGGTACAACAGCCAACTGCTTTCATTTGTGAGGGATCTGAACCAATACAGAGCAGACATAAAGGAAATGGGCCTGAGTTTACAGTGGCTGTATTCTGCTCGTGGAGACTTCTTCCGTGCTACTTCCAGACTAACAACAGATTTCGGGAATGC

Ensembl | human accession no.

ENSG00000072274

NCBI accession no.

NM_003234

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TFRC(7037) , TFRC(7037)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Markus von Nickisch-Rosenegk et al.
Journal of nanobiotechnology, 10, 1-1 (2012-01-10)
The need to functionalize cell membranes in a directed way for specific applications as single cell arrays or to force close cell-to-cell contact for artificial intercellular interaction and/or induction concerning stem cell manipulation or in general to have a tool
Tian Tang et al.
Singapore medical journal, 62(2), 96-103 (2019-11-05)
Dihydroartemisinin (DHA) is a first-line antimalarial drug with relatively low toxicity. DHA has been speculated to possess a broad-spectrum antitumour effect. However, the potential value of DHA for the treatment of endometrial carcinoma or cervical cancer is unclear. We used
Yihe Wu et al.
Thoracic cancer, 9(2), 253-261 (2017-12-30)
Transferrin receptor (TfR) is expressed in most lung cancers and is an indicator of poor prognosis in certain groups of patients. In this study, we blocked cell surface TfR to inhibit lung adenocarcinoma (LAC) cell growth in vitro and investigated
Hongwei Su et al.
Molecular cancer, 18(1), 27-27 (2019-02-21)
Circular RNA (circRNA) represents a broad and diverse endogenous RNAs that can regulate gene expression in cancer. However, the regulation and function of bladder cancer (BC) circRNAs remain largely unknown. Here we generated circRNA microarray data from three BC tissues
BumChan Park et al.
PloS one, 5(7), e11547-e11547 (2010-07-17)
Glaucoma is a major blinding disease characterized by progressive loss of retinal ganglion cells (RGCs) and axons. Optineurin is one of the candidate genes identified so far. A mutation of Glu(50) to Lys (E50K) has been reported to be associated
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service