Skip to Content
Merck
All Photos(1)

Documents

EHU078241

Sigma-Aldrich

MISSION® esiRNA

targeting human TJP1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCATTTGAACGCAAGTTTGAAAGTCCTAAATTCAATCACAATCTTCTGCCAAGTGAAACTGCACATAAACCTGACTTGTCTTCAAAAACTCCCACTTCTCCAAAAACTCTTGTGAAATCGCACAGTTTGGCACAGCCTCCTGAGTTTGACAGTGGAGTTGAAACTTTCTCTATCCATGCAGAGAAGCCTAAATATCAAATAAATAATATCAGCACAGTGCCTAAAGCTATTCCTGTGAGTCCTTCAGCTGTGGAAGAGGATGAAGATGAAGATGGTCATACTGTGGTGGCCACAGCCCGAGGCATATTTAACAGCAATGGGGGCGTGCTGAGTTCCATAGAAACTGGTGTTAGTATAATTATCCCTCAAGGAGCCATTCCCGAAGGAGTTGAGCAGGAAATCTATTTCAAGGTCTGCCGGGACAACAGCATCCTTCCACCTT

Ensembl | human accession no.

ENSG00000104067

NCBI accession no.

NM_003257

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TJP1(7082) , TJP1(7082)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mahnaz Ramezanpour et al.
Mediators of inflammation, 2016, 9798206-9798206 (2016-02-24)
Cytokine mediated changes in paracellular permeability contribute to a multitude of pathological conditions including chronic rhinosinusitis (CRS). The purpose of this study was to investigate the effect of interferons and of Th1, Th2, and Th17 cytokines on respiratory epithelium barrier
Robert L Gendron et al.
Molecular vision, 17, 2596-2604 (2011-10-26)
The rainbow smelt (Osmerus mordax), is a teleost fish, which avoids freezing by becoming virtually isosmotic with seawater. The effects that such massive changes in osmolarity have on both its visual system and its highly evolved and specialized circulation are
N T K Vo et al.
Journal of fish diseases, 39(2), 175-188 (2015-02-04)
A cell line, WE-cfin11e, with an epithelial-like morphology was developed from a caudal fin of walleye, Sander vitreus (Mitchill), characterized as distinct from the established walleye caudal fin fibroblast-like cell line, WE-cfin11f, and compared with WE-cfin11f for susceptibility to VHSV
Alexander X Cartagena-Rivera et al.
Nature communications, 8(1), 1030-1030 (2017-10-19)
Maintenance of epithelial tissue integrity requires coordination between cell-cell adherens junctions, tight junctions (TJ), and the perijunctional actomyosin cytoskeleton. Here we addressed the hypothesis that alterations in TJ structure and remodeling of the actomyosin cytoskeleton modify epithelial mechanics. Current methods
Madhavi P Maddugoda et al.
The Journal of cell biology, 178(3), 529-540 (2007-08-01)
Cooperation between cadherins and the actin cytoskeleton controls many aspects of epithelial biogenesis. We report here that myosin VI critically regulates the morphogenesis of epithelial cell-cell contacts. As epithelial monolayers mature in culture, discontinuous cell-cell contacts are initially replaced by
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service