Skip to Content
Merck
All Photos(1)

Documents

EHU055871

Sigma-Aldrich

MISSION® esiRNA

targeting human ETV5

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TACCATCGGCAAATGTCAGAACCTATTGTCCCTGCAGCTCCCCCGCCCCCTCAGGGATTCAAACAAGAATACCATGACCCACTCTATGAACATGGGGTCCCGGGCATGCCAGGGCCCCCAGCACACGGGTTCCAGTCACCAATGGGAATCAAGCAGGAGCCTCGGGATTACTGCGTCGATTCAGAAGTGCCTAACTGCCAGTCATCCTACATGAGAGGGGGTTATTTCTCCAGCAGCCATGAAGGTTTTTCATATGAAAAAGATCCCCGATTATACTTTGACGACACTTGTGTTGTGCCTGAGAGACTGGAAGGCAAAGTCAAACAGGAGCCTACCATGTATCGAGAGGGGCCCCCTTACCAGAGGCGAGGTTCCCTTCAGCTGTGGCAGTTCCTGGTCACCCTTCTTGATGACCCAGCCAATGCCCACTTCATTGCCTGGACAGGT

Ensembl | human accession no.

ENSG00000171656

NCBI accession no.

NM_004454

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ETV5(2119) , ETV5(2119)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Duy Pham et al.
The Journal of allergy and clinical immunology, 134(1), 204-214 (2014-02-04)
The differentiation of TH17 cells, which promote pulmonary inflammation, requires the cooperation of a network of transcription factors. We sought to define the role of Etv5, an Ets-family transcription factor, in TH17 cell development and function. TH17 development was examined
Félicie Cottard et al.
Oncotarget, 8(42), 72008-72020 (2017-10-27)
Constitutively active androgen receptor (AR) variants have been involved in the expression of mesenchymal markers such as N-cadherin in prostate cancer (PCa). However, the underlying molecular mechanisms remain elusive. It remains unclear, whether N-cadherin gene (CDH2) is a direct transcriptional
Jong-Min Park et al.
Free radical biology & medicine, 110, 151-161 (2017-06-13)
8-hydroxydeoxyguanosine (8-OHdG) is generated consequent to oxidative stress, but its paradoxical anti-oxidative, anti-inflammatory, and anti-mutagenic effects via Rho-GTPase inhibition were noted in various models of inflammation and cancer. Metastasis occurs through cell detachment, epithelial-mesenchymal transition (EMT), and cell migration; during
Oorvashi Roy Puli et al.
Neoplasia (New York, N.Y.), 20(11), 1121-1134 (2018-09-29)
The ETS family of transcription factors is involved in several normal remodeling events and pathological processes including tumor progression. ETS transcription factors are divided into subfamilies based on the sequence and location of the ETS domain. ETV5 (Ets variant gene
Yong Cheng et al.
PLoS pathogens, 16(5), e1008569-e1008569 (2020-05-29)
Mycobacterial infection leads to activation of the RIG-I/MAVS/TBK1 RNA sensing pathway in macrophages but the consequences of this activation remains poorly defined. In this study, we determined that activation of this RNA sensing pathway stimulates ICAM-1 expression in M.avium-infected macrophage

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service