Skip to Content
Merck
All Photos(1)

Key Documents

EHU006461

Sigma-Aldrich

MISSION® esiRNA

targeting human FLCN

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGGCCTGAGCAAGACCTACAAGTCACACCTCATGTCCACGGTCCGCAGCCCCACAGCCTCGGAGTCTCGGAACTGACCCGTCACACACACCTGCCTAAAGACAGGGATGGCTGTCCACAGGATCCTCCAGCCCCGTGAGAGGGACTGTCCCTTGAGTTTCTCAACTGCTGGAAGGAGCTGTGTCCCAGCAAGGAAGGGAAACCATCAGGGCTGGGCTCGGCCCTGTCAGGTTTGGGGCCTGTGTGCTTCCCAGACTCTCCCTCCAGCCGTTGGAATCGCTGAAGATGGCAATGAAAGGCGGAGGGATGATGGGCTCTCTCTGTGTTCAAACTCCTTGGAGAGACGACTAGGAGGACAGCTTGCCTCCCAGGCCCCTTGTGGACTTAGACTCAAAACCCGCAGGAGAAACAGGTCCGACTCAGTATGCAGTCGCAATAACATGTCTGCTCCCGAGGTTAACATTCAAGCGTTTCTACTTTGAAATTCAGCAAGAGTTTCTGGGCCTTATGTTTGAGGGTACCTTTTGCTGCAGTTGTGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Malte P Bartram et al.
BMC medical genetics, 18(1), 53-53 (2017-05-14)
Renal cell carcinoma is among the most prevalent malignancies. It is generally sporadic. However, genetic studies of rare familial forms have led to the identification of mutations in causative genes such as VHL and FLCN. Mutations in the FLCN gene
Seung-Beom Hong et al.
PloS one, 5(12), e15793-e15793 (2011-01-07)
Germline mutations in a tumor suppressor gene FLCN lead to development of fibrofolliculomas, lung cysts and renal cell carcinoma (RCC) in Birt-Hogg-Dubé syndrome. TFE3 is a member of the MiTF/TFE transcription factor family and Xp11.2 translocations found in sporadic RCC
Leeanna El-Houjeiri et al.
Cell reports, 26(13), 3613-3628 (2019-03-28)
TFEB and TFE3 are transcriptional regulators of the innate immune response, but the mechanisms regulating their activation upon pathogen infection are poorly elucidated. Using C. elegans and mammalian models, we report that the master metabolic modulator 5'-AMP-activated protein kinase (AMPK) and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service