Skip to Content
Merck
All Photos(1)

Documents

EHU094011

Sigma-Aldrich

MISSION® esiRNA

targeting human ITPR1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCTGACCTGAGGAGTGAGAAGCAGAAGAAGGAAGAGATCTTGAAGACCACGTGCTTTATCTGTGGCTTGGAAAGAGACAAGTTTGACAACAAGACTGTCACCTTTGAAGAGCACATCAAGGAAGAACACAACATGTGGCACTATCTGTGCTTCATCGTCCTGGTGAAAGTAAAGGACTCCACCGAATATACTGGGCCTGAGAGTTACGTGGCAGAAATGATCAAGGAAAGAAACCTTGACTGGTTCCCCAGGATGAGAGCCATGTCATTGGTCAGCAGTGATTCTGAAGGAGAACAGAATGAGCTGAGAAACCTGCAGGAGAAGCTGGAGTCCACCATGAAACTTGTCACGAACCTTTCTGGCCAGCTGTCGGAATTAAAGGATCAGATGACAGAACAAAGGAAGCAGAAACAAAGAATTGG

Ensembl | human accession no.

ENSG00000150995

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ITPR1(3708) , ITPR1(3708)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ting Yu et al.
Experimental cell research, 399(2), 112438-112438 (2020-12-29)
Palmitic acid (PA)-induced hepatocyte apoptosis is critical for the progression of nonalcoholic fatty liver disease (NAFLD). Inositol 1,4,5-trisphosphate receptor type 1 (IP3R1) is an intracellular Ca2+-release channel and is involved in PA-induced hepatocyte apoptosis. While the expression of IP3R1 is
Jie Tong et al.
Biochimica et biophysica acta, 1864(12), 2389-2401 (2017-10-01)
The mechanism by which cell shape regulates the function of the cell is one of the most important biological issues, but it remains unclear. Here, we investigated the effect of the regulation of cell shape on proliferation by using a
Raul Lagos-Cabré et al.
Cell reports, 33(11), 108483-108483 (2020-12-17)
The mitotic spindle distributes chromosomes evenly to daughter cells during mitosis. The orientation of the spindle, guided by internal and external cues, determines the axis of cell division and thereby contributes to tissue morphogenesis. Progression through mitosis requires local Ca2+
Yi-Dong Yang et al.
Journal of cellular biochemistry, 120(11), 18967-18978 (2019-06-27)
Mitochondrial dysfunction plays a principal role in hypoxia-induced endothelial injury, which is involved in hypoxic pulmonary hypertension and ischemic cardiovascular diseases. Recent studies have identified mitochondria-associated membranes (MAMs) that modulate mitochondrial function under a variety of pathophysiological conditions such as high-fat diet-mediated
Vishal R Yadav et al.
American journal of physiology. Lung cellular and molecular physiology, 314(5), L724-L735 (2018-02-02)
Hypoxia-induced pulmonary vasoconstriction (HPV) is attributed to an increase in intracellular Ca2+ concentration ([Ca2+]i) in pulmonary artery smooth muscle cells (PASMCs). We have reported that phospholipase C-γ1 (PLCγ1) plays a significant role in the hypoxia-induced increase in [Ca2+]i in PASMCs
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service