Skip to Content
Merck
All Photos(1)

Key Documents

EHU082301

Sigma-Aldrich

MISSION® esiRNA

targeting human OGT

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAAAACTGCAGGAAGCTCTGATGCATTATAAGGAGGCTATTCGAATCAGTCCTACCTTTGCTGATGCCTACTCTAATATGGGAAACACTCTAAAGGAGATGCAGGATGTTCAGGGAGCCTTGCAGTGTTATACGCGTGCCATCCAAATTAATCCTGCATTTGCAGATGCACATAGCAATCTGGCTTCCATTCATAAGGATTCAGGGAATATTCCAGAAGCCATAGCTTCTTACCGCACGGCTCTGAAACTTAAGCCTGATTTTCCTGATGCTTATTGTAACTTGGCTCATTGCCTGCAGATTGTCTGTGATTGGACAGACTATGATGAGCGAATGAAGAAGTTGGTCAGTATTGTGGCTGACCAGTTAGAGAAGAATAGGTTGCCTTCTGTGCATCCTCATCA

Ensembl | human accession no.

ENSG00000147162

NCBI accession no.

NM_181673

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... OGT(8473) , OGT(8473)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yubo Liu et al.
Journal of cellular physiology, 234(10), 17527-17537 (2019-02-23)
Bortezomib (BTZ), a well-established proteasome inhibitor used in the clinical therapy, leads the modulation of several biological alterations and in turn induces apoptosis. Although clinical trials with BTZ have shown promising results for some types of cancers, but not for
Lan V Pham et al.
Oncotarget, 7(49), 80599-80611 (2016-10-08)
The hexosamine biosynthetic pathway (HBP) requires two key nutrients glucose and glutamine for O-linked N-acetylglucosamine (O-GlcNAc) cycling, a post-translational protein modification that adds GlcNAc to nuclear and cytoplasmic proteins. Increased GlcNAc has been linked to regulatory factors involved in cancer
K M Kampa-Schittenhelm et al.
EBioMedicine, 54, 102678-102678 (2020-04-10)
Overriding the differentiation blockage in acute myeloid leukemia (AML) is the most successful mode-of-action in leukemia therapy - now curing the vast majority of patients with acute promyelocytic leukemia (APL) using all-trans retinoic acid (ATRA)-based regimens. Similar approaches in other
Anna Barkovskaya et al.
Scientific reports, 10(1), 16992-16992 (2020-10-14)
In this study, we probed the importance of O-GlcNAc transferase (OGT) activity for the survival of tamoxifen-sensitive (TamS) and tamoxifen-resistant (TamR) breast cancer cells. Tamoxifen is an antagonist of estrogen receptor (ERα), a transcription factor expressed in over 50% of
Ewa Forma et al.
PloS one, 13(6), e0198351-e0198351 (2018-06-05)
Enhancer of zest homolog 2 (EZH2) is a histone methyltransferase which plays a crucial role in cancer progression by regulation of genes involved in cellular processes such as proliferation, invasion and self-renewal. Activity and biological function of EZH2 are regulated
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service