HLTUD1584
MISSION® Lenti microRNA Inhibitor, Human
hsa-miR-3664-3p
Sinónimos:
Tough Decoy, TuD
Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
About This Item
Código UNSPSC:
41106609
NACRES:
NA.51
El producto HLTUD1584 no se vende actualmente en su país Póngase en contacto con el Servicio técnico
Nivel de calidad
Línea del producto
MISSION®
Formulario
liquid
concentración
≥1x106 VP/ml (via p24 assay)
técnicas
capture ELISA: 106 TU/mL using p24 (Volume 200 uL)
secuencia madura
UCUCAGGAGUAAAGACAGAGUU
Nº de acceso Sanger mature/minor
Nº de acceso Sanger microRNA
Condiciones de envío
dry ice
temp. de almacenamiento
−70°C
Descripción general
Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.
- Allows for potent inhibition of the desired miRNA
- Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
- Enables long-term inhibition without repeat transfection
Otras notas
Based on miRBase V19 Mature ID
Información legal
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Código de clase de almacenamiento
12 - Non Combustible Liquids
Clase de riesgo para el agua (WGK)
WGK 3
Punto de inflamabilidad (°F)
Not applicable
Punto de inflamabilidad (°C)
Not applicable
Elija entre una de las versiones más recientes:
Certificados de análisis (COA)
Lot/Batch Number
Lo sentimos, en este momento no disponemos de COAs para este producto en línea.
Si necesita más asistencia, póngase en contacto con Atención al cliente
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
Filtros activos
Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.
Póngase en contacto con el Servicio técnico
