HLTUD0979

MISSION^® Lenti microRNA Inhibitor, Human

hsa-miR-95

• Sinónimos: Tough Decoy, TuD
• Código UNSPSC: 41106609
• NACRES: NA.51

Propiedades

• Línea del producto: MISSION^®
• formulario: liquid
• concentración: ≥1x10⁶ VP/ml (via p24 assay)
• técnicas: capture ELISA: 10⁶ TU/mL using p24 (Volume 200 uL)
• secuencia madura: UUCAACGGGUAUUUAUUGAGCA
• Nº de acceso Sanger mature/minor: MIMAT0000094
• Nº de acceso Sanger microRNA: MI0000097
• Condiciones de envío: dry ice
• temp. de almacenamiento: −70°C

Descripción

Descripción general

Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.

• Allows for potent inhibition of the desired miRNA
• Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
• Enables long-term inhibition without repeat transfection

Otras notas

Based on miRBase V19 Mature ID

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Información de seguridad

• Código de clase de almacenamiento: 12 - Non Combustible Liquids
• Clase de riesgo para el agua (WGK): WGK 3
• Punto de inflamabilidad (°F): Not applicable
• Punto de inflamabilidad (°C): Not applicable