Saltar al contenido
Merck

HLMIR2295

Sigma-Aldrich

MISSION® Lenti microRNA, Human

hsa-miR-519d-5p

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41106609
NACRES:
NA.51

Línea del producto

MISSION®

formulario

liquid

concentración

≥1x106 VP/ml (via p24 assay)

secuencia madura

CCUCCAAAGGGAAGCGCUUUCUGUU

Nº de acceso Sanger mature/minor

Nº de acceso Sanger microRNA

Condiciones de envío

dry ice

temp. de almacenamiento

−70°C

Descripción general

Sigma′s Mission Lenti-miRs express miRNAs from a common backbone, whose structure meets requirements for accurate Dicer processing and a partially complementary strand is designed to mimic the base pairing pattern in the backbone structure using a proprietary algorithm. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Each miRNA construct has been cloned and sequence verified. Mature microRNA sequences are obtained from miRBase.

Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. The polymerase II promoter, elongation factor 1 alpha (EF1A), was chosen to drive miRNA expression needed for reverse transcription of viral RNA and integration of viral DNA into the host cell genome. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory element allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells. Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration of the specific miRNA construct into differentiated and non-dividing cells, such as neurons and dendritic cells.

Otras notas

Based on miRBase V20 Mature ID

Productos recomendados

Two negative controls are available: NCLMIR001 and NCLMIR002

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

control

Referencia del producto
Descripción
Precios

Código de clase de almacenamiento

12 - Non Combustible Liquids

Clase de riesgo para el agua (WGK)

WGK 3

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico