Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EMU213731

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Atr

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAGAATTTGCTTCTGTCCTTGGTCAACTTGTCTGTACTCTTCACGGCATGTTTTATTTGAGTTCCTCAGTAGAGCCTTGCTTTGAACATATGGACTTGTTCAGTAAGAACCTGAAAGCCACTTCTCAGCATGAATGTTCATCTTCTCAAGTAAAAGCTTCCACTTGCAAGCCATTCCTTTTCCTGCTGACCAAAAATACACCTAGTCCAGTAAAACTTGCTTTCATAGACAATCTACATCATCTTTGTAAGCATCTTGATTTTCAAGAAGATGAAAGAGAGGTAAAAGCAGTTCTTGGGACTTTATTAAATTTGATGGAAGATCCAGACAAGGATGTTAGAATTGCTTTTAGTGGAAATATCAAGTATATATTGGAATCCTTGAACTCTGAAGATGGATTCGTAAAAGAGCTTTTTGTCTTAAGAATGAAGGAAGCATATACTCATGCCCAAATAGCAAGGAATAATGAGCTAAAGGATACTTTGATTCTTACAACAGGGGATATTGGAA

Ensembl | nº de acceso | ratón

ENSMUSG00000032409

Nº de acceso NCBI

NM_019864

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... ATR(245000) , Atr(245000)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Amit Kumar et al.
PloS one, 9(6), e100228-e100228 (2014-06-28)
The Kaposi's sarcoma-associated herpesvirus infects the human population and maintains latency stage of viral life cycle in a variety of cell types including cells of epithelial, mesenchymal and endothelial origin. The establishment of latent infection by KSHV requires the expression
Maude Gabriel et al.
BMC cancer, 15, 227-227 (2015-04-18)
Modification of splicing by chemotherapeutic drugs has usually been evaluated on a limited number of pre-mRNAs selected for their recognized or potential importance in cell proliferation or apoptosis. However, the pathways linking splicing alterations to the efficiency of cancer therapy

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico