Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU210421

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Erbb2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTCTGTCCCCCGAACAACCAAGAGGTCACAGCTGAGGACGGAACACAGCGGTGTGAGAAATGCAGCAAGCCCTGTGCTGGAGTATGCTATGGTCTGGGCATGGAGCACCTCCGAGGGGCGAGGGCCATCACCAGTGACAATATCCAGGAGTTTGCTGGCTGCAAGAAGATCTTTGGGAGCCTGGCATTTTTGCCGGAGAGCTTTGATGGGAACCCCTCCTCCGGCGTTGCCCCACTGAAGCCAGAGCATCTCCAAGTGTTCGAAACCCTGGAGGAGATCACAGGTTACCTATACATTTCAGCATGGCCAGAGAGCTTCCAAGACCTCAGTGTCTTCCAGAACCTTCGGGTCATTCGGGGACGGATTCTCCATGATGGTGCTTACTCATTGACGTTGCAAGGCCTGGGGATTCACTCACTGGGGCTACGCTCACTGCGGGAGCTGGGCAGTGGATTGGCTCTCATTCACCGCAACACCCATCTCTGCTTTGTAAACACTGTACCTTGGGACCA

Ensembl | nº de acceso | ratón

ENSMUSG00000062312

Nº de acceso NCBI

NM_001003817

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... ERBB2(13866) , Erbb2(13866)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chiao-Yun Lin et al.
Journal of molecular medicine (Berlin, Germany), 92(9), 969-981 (2014-05-14)
Endometrial cancers have been recently molecularly characterized; amplifications of human epidermal growth factor receptor 2 (HER2) were seen in 25 % of the serous-like tumors, and mutations in the PI(3)K/AKT pathways were seen in 93 % of endometrioid tumors. These new findings
Hanyin Cheng et al.
Cancer research, 75(13), 2737-2748 (2015-05-09)
Uveal melanoma patients with metastatic disease usually die within one year, emphasizing an urgent need to develop new treatment strategies for this cancer. MEK inhibitors improve survival in cutaneous melanoma patients but show only modest efficacy in metastatic uveal melanoma
Yu-Chieh Tsai et al.
Molecular cancer therapeutics, 14(3), 810-820 (2015-01-16)
Blockade of EGFR has been proved useful in enhancing the effect of radiotherapy, but the advantages of new-generation EGFR tyrosine kinase inhibitors (TKI) in radiosensitization are not well known. We used two human bladder cancer cells with wild-type EGFR to

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico