Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EMU204151

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Lin28b

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAACCCCAGGTTCTGCATGGCACTGGCCACTGTAAATGGTTCAACGTGCGCATGGGATTCGGATTCATCTCCATGATAAGTCGAGAGGGAAATCCCTTGGATATTCCAGTGGATGTATTTGTACACCAAAGCAAACTATTCATGGAAGGATTTAGAAGCTTGAAAGAAGGAGAGCCAGTGGAATTTACATTTAAAAAATCCCCCAAAGGCCTTGAGTCAATACGGGTAACAGGCCCAGGTGGGAGCCCCTGCTTAGGAAGTGAAAGAAGACCTAAAGGGAAGACCCTGCAAAAGAGAAAGCCAAAGGGAGA

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chong Chen et al.
Cancer research, 75(8), 1725-1735 (2015-03-07)
Considerable evidence suggests that proinflammatory pathways drive self-renewal of cancer stem-like cells (CSC), but the underlying mechanisms remain mainly undefined. Here we report that the let7 repressor LIN28B and its regulator IKBKB (IKKβ) sustain cancer cell stemness by interacting with
B-X Yan et al.
Oncogene, 33(45), 5288-5294 (2013-11-05)
Tumor drug resistance remains a major challenge in the treatment of cancer. Here, we show that Prostatic secretory protein 94 (PSP94) levels are reduced in ovarian cancer patients with high levels of excision repair cross-complementing 1 (ERCC1), a marker for

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico