Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EMU203261

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Socs1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCTGCTGTGCAGAATATCCTATTTTATATTTTTACAGCCAGTTTAGGTAATAAACTTTATTATGAAAGTTTTTTTTTAAAAGAAACAAAGATTCCTAGAGCGTATGCTTTGGCCAAACGTCCTGGGTTGGGAGTGGGGTATACAGACTGACTTTTCTTGAAGTCTTCGGGATGCTGGGGGGAGGGGGGAGGGTCGGACATCATATACATCTCCACCCACAGTGATGGGGACCAAACTTCCAGGCTAGTTGTGGTTTATGACTGGGAAGATGGCCGCTCCTGAGTATCCGTGCCTGGTCTCTGGTATTTCTGTGATGGGATCCTACAGGGACAGCCCCTGACACTGAGTACTGTGTTGCCCCCAGTATACAGAGGAGAAAACTGAGAGACGGGTAATTGACGACAGACCATTCCTGGACTGGAGAGGTGGGCCTTTTAACTGTCCATCCTGCATCAATTTGAAATGGATGACAGAGAGGAAACTTCTTTGCTTCTCTGACCACAACTACTTCCAGGA

Ensembl | nº de acceso | ratón

ENSMUSG00000038037

Nº de acceso NCBI

NM_009896

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... SOCS1(12703) , Socs1(12703)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hua-Bing Li et al.
Nature, 548(7667), 338-342 (2017-08-10)
N
Gang Xu et al.
Virology, 462-463, 343-350 (2014-07-16)
MiR-221 was reported to be upregulated and play roles in tumorigenesis of hepatitis C virus (HCV) associated hepatocellular carcinoma (HCC). However, the role of miR-221 in HCV infection remains unknown. In this study, it was found that miR-221 was upregulated
Wai Po Chong et al.
Immunity, 53(2), 384-397 (2020-07-17)
Dysregulated Th17 cell responses underlie multiple inflammatory and autoimmune diseases, including autoimmune uveitis and its animal model, EAU. However, clinical trials targeting IL-17A in uveitis were not successful. Here, we report that Th17 cells were regulated by their own signature
Chulwon Kim et al.
Oncotarget, 6(6), 4020-4035 (2015-03-05)
Artesunate (ART), a semi-synthetic derivative of artemisinin, is one of the most commonly used anti-malarial drugs. Also, ART possesses anticancer potential albeit through incompletely understood molecular mechanism(s). Here, the effect of ART on various protein kinases, associated gene products, cellular

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico