Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EMU175511

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ensmusg00000055408

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAAAGAGACGAAGTACGGTTCCAGGCTCCAATTCTCGGAGACTCTCGGAGACTCGAGGGCAGTTTACATACAGGTCAGACACGCTGGAGGCCAAGGTCAAGTTGAAAGTTGCTGTCTAGTCAGCGTGAGAAACTACAATGAAAGCCCAGAGACAGAGCCGACTGCCCACCTCCCCTCGCTCTCAATTCCCCCATCCTTTGCTATCTGGCTTCTGGCTCTGTTTGGTTTCTCAGCATCTTTTTTTTTTCCCTCTCTCTTTGTAGAGTTTTGGGGGCGGTGTTTACAGGCTGGACTGGTTCTTTTCTGTCGGCCGCCCTGCTCTTAGCTGGGTTTCTGAACCTCCGAAGTTTTCCAGCTAGGTTCGGAAAAAACGAAAACACAGCTCAGGAAGGCTCCACCAGCCGATGCCTATGCCAGTTCACCTCTGGCAGTGGCTGTACTGCTGGTCCACACAGCAGCCAAGACCAGCTCCACGTTCTTTCCTCCCCCTCAGTTCACTGGAGCCGGGAG

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yunxia Ge et al.
PLoS genetics, 11(12), e1005726-e1005726 (2015-12-29)
Accumulated evidence demonstrated that long non-coding RNAs (lncRNAs) play a pivotal role in tumorigenesis. However, it is still largely unknown how these lncRNAs were regulated by small ncRNAs, such as microRNAs (miRNAs), at the post-transcriptional level. We here use lncRNA
H-P Deng et al.
Cellular and molecular biology (Noisy-le-Grand, France), 61(4), 34-40 (2015-08-13)
Lung cancer is one of the leading causes of cancer-related deaths worldwide. Early diagnosis is the best defense against this threat and is therefore of vital importance. In this study, we investigated the role of long non-coding RNA HOTTIP in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico