Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU094441

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ptprj

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTGTGGGTTTGCAGAGGAATATGAGGACCTGAAGCTGATTGGGATAAGTTTACCTAAATACACAGCTGAGATAGCCGAGAACAGAGGGAAGAACCGCTACAACAATGTTCTGCCCTATGATATTTCTCGAGTCAAACTTTCAGTCCAGACCCATTCGACAGATGACTACATCAATGCCAACTATATGCCTGGCTACCATTCCAAGAAAGATTTCATTGCCACACAAGGACCTTTACCCAACACTTTGAAAGATTTCTGGCGTATGGTTTGGGAGAAAAACGTATATGCCATTGTTATGTTGACCAAATGCGTGGAGCAGGGAAGGACCAAATGTGAGGAGTACTGGCCTTCCAAGCAGGCTCAGGACTACGGGGACATAACTGTGGCGATGACATCAGAAGTCGTTCTTCCAGAATGGACC

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Gregory C Sartor et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 35(45), 15062-15072 (2015-11-13)
Epigenetic processes that regulate histone acetylation play an essential role in behavioral and molecular responses to cocaine. To date, however, only a small fraction of the mechanisms involved in the addiction-associated acetylome have been investigated. Members of the bromodomain and
K Spring et al.
Oncogene, 34(44), 5536-5547 (2015-03-17)
DEP-1/PTPRJ is a receptor-like protein tyrosine phosphatase mainly known for its antiproliferative and tumor-suppressive functions. Many identified substrates are growth factor receptors, and DEP-1 is deleted and/or mutated in human cancers including that of the breast. However, DEP-1 was also
Xiaoling Luo et al.
OncoTargets and therapy, 8, 3159-3167 (2015-11-26)
Interaction between microRNA (miR-328) and PTPRJ (protein tyrosine phosphatase, receptor type, J) has been reported to be responsible for miR-328-dependent increase in epithelial cancer cell proliferation. However, the role of miR-328 and PTPRJ in hepatocellular carcinoma (HCC) remains unclear. The

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico