Todas las fotos(1)

Documentos clave

Certificado de origen (COO)/COA

EMU093231

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting mouse Akr1b7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Todas las fotos(1)

About This Item

Código UNSPSC:

41105324

NACRES:

NA.51

descripción

Nivel de calidad

100

Línea del producto

MISSION^®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CACCCTTATCTCACCCAGGAAAAACTGATCCAATACTGTCAATCCAAGGGCATCGCTGTTACAGCCTACAGTCCCCTGGGCTCCCCAGACAGGCCTTATGCCAAGCCAGAAGACCCCGTAGTAATGGAGATTCCCAAGATCAAAGAGATTGCTGCAAAACACAAGAAAACAGTAGCTCAGGTTCTGATTCGGTTCCATGTCCAAAGGAATGTGGTGGTGATCCCCAAGTCTGTGACACCCTCACGCATACAGGAGAACCTGCAGGTCTTCGACTTCCAGTTGAGTGAGGAGGACATGGCTGCCATTCTCAGCTTCAACAGGAACTGGAGGGCCTGTGACCTGTTGGATGCAAGGACTGAAGAGGACTATCCTTTCCACGAGGAATACTGAGGTCCACTTGCTTGATGAGATCCGTGCATGAT

Ensembl | nº de acceso | ratón

ENSMUSG00000052131

Nº de acceso NCBI

NM_009731

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... AKR1B7(11997) , Akr1b7(11997)

Categorías relacionadas

MISSION® esiRNA

Oligos, qPCR Probes & Peptides

Descripción general

MISSION^® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Multiple molecular subtypes of triple-negative breast cancer critically rely on androgen receptor and respond to enzalutamide in vivo.

Valerie N Barton et al.

Molecular cancer therapeutics, 14(3), 769-778 (2015-02-26)

Triple-negative breast cancer (TNBC) has the lowest 5-year survival rate of invasive breast carcinomas, and currently there are no approved targeted therapies for this aggressive form of the disease. The androgen receptor (AR) is expressed in up to one third

Novel regulatory program for norepinephrine-induced epithelial-mesenchymal transition in gastric adenocarcinoma cell lines.

Tao Shan et al.

Cancer science, 105(7), 847-856 (2014-05-13)

Norepinephrine and epinephrine, catecholamine hormones that are major mediators for chronic stress-induced cancers, are implicated in the progression of a number of cancer cells, including gastric adenocarcinoma. However, the underlying mechanisms of these hormones have not been well elucidated. Epithelial-mesenchymal

Preparation of nanobubbles carrying androgen receptor siRNA and their inhibitory effects on androgen-independent prostate cancer when combined with ultrasonic irradiation.

Luofu Wang et al.

PloS one, 9(5), e96586-e96586 (2014-05-07)

The objective of this study was to investigate nanobubbles carrying androgen receptor (AR) siRNA and their in vitro and in vivo anti-tumor effects, when combined with ultrasonic irradiation, on androgen-independent prostate cancer (AIPC). Nanobubbles carrying AR siRNA were prepared using

Adenosine A2B receptor stimulates angiogenesis by inducing VEGF and eNOS in human microvascular endothelial cells.

Xiaolong Du et al.

Experimental biology and medicine (Maywood, N.J.), 240(11), 1472-1479 (2015-05-15)

Angiogenesis is critical to wound repair due to its role in providing oxygen and nutrients that are required to support the growth and function of reparative cells in damaged tissues. Adenosine receptors are claimed to be of paramount importance in

Identification and characterization of membrane androgen receptors in the ZIP9 zinc transporter subfamily: I. Discovery in female atlantic croaker and evidence ZIP9 mediates testosterone-induced apoptosis of ovarian follicle cells.

A Håkan Berg et al.

Endocrinology, 155(11), 4237-4249 (2014-07-12)

Rapid, cell surface-initiated, pregenomic androgen actions have been described in various vertebrate cells, but the receptors mediating these actions remain unidentified. We report here the cloning and expression of a cDNA from Atlantic croaker (Micropogonias undulatus) ovaries encoding a 33-kDa

Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico