Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU089831

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Sp7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCTTTACCAGAAGCGACCACTTGAGCAAACATCAGCGCACCCACGGGGAGCCAGGCCCGGGACCGCCCCCAAGTGGCCCTAAGGAGCTGGGGGAGGGTCGCAGCGTCGGGGAAGAAGAAGCCAATCAGCCGCCCCGATCTTCCACTTCGCCTGCACCCCCAGAAAAAGCCCACGGAGGCAGCCCAGAGCAGAGCAACCTGCTAGAGATCTGAGCCGGGTAGAGGAAGGTCTCCAGCTCCAGGGTCCTCTTGCCAGGCTCTCTTGGCGTGCTGGACCCATTGGTTGCCCCTCGCTCTCTCCTATTGCATGCTATACTCTGGGGGCTCTCTCTGTTCCCCTAGGCTATCTCCTTGCATGTCTCCTCAGTTCTTCTCTCTTTGTCAAGAGTCTTAGCCAAACTCCTCTCAGGCCTTTGCCAGTGCCTAGTTCCTATGCTCCGACCTCCTCAACTTTTTCTTCTCTGCCCCTGTTCTTCACAGCTTCCATCTGGCCTCACATCATTTTCTCATTAACTCGTTGCCATCTAATCTTTCTGCTTCCCAATCCTATTTGC

Ensembl | nº de acceso | ratón

ENSMUSG00000060284

Nº de acceso NCBI

NM_130458

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... SP7(170574) , Sp7(170574)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ning Li et al.
Molecular therapy. Nucleic acids, 22, 971-980 (2020-12-01)
Calcific aortic valve disease (CAVD) is a common heart valve disease in aging populations, and aberrant osteogenic differentiation of valvular interstitial cells (VICs) plays a critical role in the pathogenesis of ectopic ossification of the aortic valve. miR-214 has been
Wen-lin Xiao et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 36(3), 1015-1025 (2015-06-27)
The relationship between the p38MAPK signaling pathway and osterix in osteogenic differentiation of BMMSCs subjected to intermittent stretching was investigated. BMMSCs derived from C57BL/6J mice were divided into the following groups: 1) control, 2) stretch, and 3) SB203580+stretch (SB203580 is
Y Zhang et al.
Oral diseases, 21(5), 583-592 (2015-02-05)
To understand the differences and similarities between immunocompetent and immunodeficient mice as ectopic transplantation animal models for bone tissue engineering. Osteogenic cells from mouse leg bones were cultured, seeded on β-TCP granules, and transplanted onto the backs of either immunocompetent

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico