Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EMU082531

Sigma-Aldrich

MISSION® esiRNA

targeting mouse F11r

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TATGATCCTGGGCTCTTTGGTACAAGGCAAGGGTTCGGTGTACACTGCTCAATCTGACGTCCAGGTTCCCGAGAACGAGTCCATCAAATTGACCTGCACCTACTCTGGCTTCTCCTCTCCCCGAGTGGAGTGGAAGTTCGTCCAAGGCAGCACAACTGCACTTGTGTGTTATAACAGCCAGATCACAGCTCCCTATGCGGACCGAGTCACCTTCTCATCCAGTGGCATCACGTTCAGTTCTGTGACCCGGAAGGACAATGGAGAGTATACTTGCATGGTCTCCGAGGAAGGTGGCCAGAACTACGGGGAGGTCAGCATCCACCTCACTGTGCTTGTACCTCCATCCAAGCCGACGATCAGTGTCCCCTCCTCTGTCACCATTGGGAACAGGGCAGTGCTGACCTGCTCAGAGCATGATGGTTCCCCACCCTCTGAATATTCCTGGTTCAAGGACGGGATATCCATGCTTACAGCAGATGC

Ensembl | nº de acceso | ratón

ENSMUSG00000038235

Nº de acceso NCBI

NM_172647

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... F11R(16456) , F11r(16456)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Nikola Sladojevic et al.
Neurobiology of disease, 67, 57-70 (2014-03-25)
Proinflammatory mediators trigger intensive postischemic inflammatory remodeling of the blood-brain barrier (BBB) including extensive brain endothelial cell surface and junctional complex changes. Junctional adhesion molecule-A (JAM-A) is a component of the brain endothelial junctional complex with dual roles: paracellular route
Hüseyin Tuncay et al.
Nature communications, 6, 8128-8128 (2015-08-27)
Planar spindle orientation in polarized epithelial cells depends on the precise localization of the dynein-dynactin motor protein complex at the lateral cortex. The contribution of cell adhesion molecules to the cortical localization of the dynein-dynactin complex is poorly understood. Here

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico