Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU079271

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Macc1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCACATCTGGCACAGGAAGATTTTAATAGAATTCAAGCAGACAAGGAACCAGAAAGGGTTTCTTACGTTGTCAAGAAGTTAAAGGAAGATTGCCATGAAGATAGAAATACCAGGAAGTTCCTTTATGAACTGATTGTGGCTCTGCTAAAAATGGATTGCCAAGAGTTAGTGGCACATCTTATCCAAGAGGCTGTTATTCTGACTTCAGCTGTGAAACTTGGAAGAAGCTGGAGGGAACTTGCTGAGAAATCTGCAGGACTCACTAAGCATCAGATGCAGGCATATGAAATTCCTCACCGAGGAAAATCTGGAGATGTTTCAGCAGAGATGATGTGGAAACCTGCCTATGATTTTCTCTATGCATGGAGTTTTCACTATGGAAATAGCTACAGAGATGTGTTACAAGATCTTCAATCAGCTTTGGACAGAATGAAAAACCCTGTCACTAAACGGTGGAGA

Ensembl | nº de acceso | ratón

ENSMUSG00000041886

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... MACC1(238455) , Macc1(238455)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
AOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yaoqing Li et al.
Molecular medicine reports, 12(1), 426-434 (2015-03-05)
Metastasis-associated in colon cancer-1 (MACC1) is a newly identified gene that is involved in the development and progression of hepatocellular carcinoma (HCC), however its investigation has not been comprehensive. In the present study, in vitro techniques, including immunohistochemistry, western blotting
Aiko Sueta et al.
International journal of oncology, 46(5), 2143-2153 (2015-03-05)
The newly identified gene, metastasis‑associated in colon cancer 1 (MACC1), is suggested to be a transcriptional regulator of c‑Met, leading to cancer progression in colorectal cancer. To date however, little is known of the role of MACC1 in breast cancer.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico