Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU077671

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Sod2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAGGAGCAAGGTCGCTTACAGATTGCTGCCTGCTCTAATCAGGACCCATTGCAAGGAACAACAGGCCTTATTCCGCTGCTGGGGATTGACGTGTGGGAGCACGCTTACTACCTTCAGTATAAAAACGTCAGACCTGACTATCTGAAAGCTATTTGGAATGTAATCAACTGGGAGAATGTTACTGAAAGATACACAGCTTGCAAGAAGTGAAACCTCACTCACGGCCACATTGAGTGCCAGGCTCCGGGCTGGTTTATAGTAGTGTAGAGCATTGCAGCACTATGACTGGGGTGCTGTAGTCTTTATTGATGTCTTTCCACATACCTGATAATTCTATGATAATTTCTTATTTTAATTAAATCTATTCTTAGGCAACTATTTGAGAACAGCGCATACTCTGTGTGAATTGCTCTTGATTGAACATTTTCGTTAGAGCCTTGAATTGCTTGGA

Ensembl | nº de acceso | ratón

ENSMUSG00000006818

Nº de acceso NCBI

NM_013671

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... SOD2(20656) , Sod2(20656)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Vonetta M Williams et al.
Journal of virology, 88(12), 6751-6761 (2014-04-04)
High-risk types of human papillomavirus (HPV) are the causative agents of virtually all cases of cervical cancer and a significant proportion of other anogenital cancers, as well as both oral and pharyngeal cancers. The high-risk types encode two viral oncogenes
Y Xu et al.
Oncogene, 34(32), 4229-4237 (2014-11-05)
Manganese superoxide dismutase (MnSOD) is a mitochondrially localized primary antioxidant enzyme, known to be essential for the survival of aerobic life and to have important roles in tumorigenesis. Here, we show that MnSOD deficiency in skin tissues of MnSOD-heterozygous knockout
Jiahong Sun et al.
Molecular pharmacology, 88(3), 437-449 (2015-06-18)
Oxidative stress is linked to mitochondrial dysfunction in aging and neurodegenerative conditions. The transcription factor nuclear factor E2-related factor 2 (Nrf2)-antioxidant response element (ARE) regulates intracellular antioxidative capacity to combat oxidative stress. We examined the effect of tert-butylhydroquinone (tBHQ), an
Sabrina Krautbauer et al.
Molecular and cellular biochemistry, 393(1-2), 69-76 (2014-04-18)
Adipogenesis is associated with the upregulation of the antioxidative enzyme manganese superoxide dismutase (MnSOD) suggesting a vital function of this enzyme in adipocyte maturation. In the current work, MnSOD was knocked-down with small-interference RNA in preadipocytes to study its role
Yasuhiro Ishihara et al.
The Journal of biological chemistry, 290(37), 22805-22817 (2015-08-02)
Microglia are activated quickly in response to external pathogens or cell debris and clear these substances via the inflammatory response. However, excessive activation of microglia can be harmful to host cells due to the increased production of reactive oxygen species

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico