Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU073651

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fcgr3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TACACAGCACCAGTCCAAGCCTGTCACCATCACTGTCCAAGATCCAGCAACTACATCCTCCATCTCTCTAGTCTGGTACCACACTGCTTTCTCCCTAGTGATGTGCCTCCTGTTTGCAGTGGACACGGGCCTTTATTTCTACGTACGGAGAAATCTTCAAACCCCGAGGGAGTACTGGAGGAAGTCCCTGTCAATCAGAAAGCACCAGGCTCCTCAAGACAAGTGACACCCCATCCATCCTATGGCAAAACATACGATGTTTTGGTGGCAGCAGCAACTTTTCAGCCACACAGCCTTCCTTTGAAAGCAACTTACAAGCAGGCCGGGATGTTTGGTTCTTCAATCACAACGACTTAGGATCACCAGTTCAAGGCTTGCTGGGTCACACAGAGAGAGTGAGTGCAAGTCTAGCCTGGATAACCCAGTGAGATCCTGGG

Ensembl | nº de acceso | ratón

ENSMUSG00000059498

Nº de acceso NCBI

NM_010188

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... Fcgr3(14131)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Martina Schmittnaegel et al.
Cancer immunology research, 3(7), 764-776 (2015-02-19)
Tumor cells escape immune eradication through multiple mechanisms, including loss of antigenicity and local suppression of effector lymphocytes. To counteract these obstacles, we aimed to direct the unique cytomegalovirus (CMV)-specific immune surveillance against tumor cells. We developed a novel generation
Siva K Gandhapudi et al.
Journal of immunology (Baltimore, Md. : 1950), 194(8), 3820-3828 (2015-03-18)
Although IL-18 has not previously been shown to promote T lymphopoiesis, results obtained via a novel data mining algorithm (global microarray meta-analysis) led us to explore a predicted role for this cytokine in T cell development. IL-18 is a member
Wai W Lin et al.
Science signaling, 8(392), ra88-ra88 (2015-09-04)
Tumor necrosis factor receptor-associated factor 3 (TRAF3) is an adaptor protein that inhibits signaling by CD40 and by the receptor for B cell-activating factor (BAFF) and negatively regulates homeostatic B cell survival. Loss-of-function mutations in TRAF3 are associated with human

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico