Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU072881

Sigma-Aldrich

MISSION® esiRNA

targeting mouse 1190002h23rik

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGCGCCACTTCCACTATGAGGAGCACCTAGAGCGCATGAAGCGGCGCAGCAGCGCCAGCATCAGCAACAGCAGCGGCTTCAGCGACTCGGAGAGTGCAGACTCAGTGTACAGGGACAGCTTCACCTTCAGTGATGAGAAGCTGAATTCTCCAACCAACTCCTCTCCAGCTCTCCTGCCCTCCGCTGTCACTCCTCGGAAAGCCAAATTAGGTGACACTAAAGAGCTCGAAGACTTCATTGCCGATCTGGACAGGACCTTAGCAAGTATGTGAAGCAAGGAGTTTGGGGTCCAGAAGGCTCCGAGGACCTGGCAAATCGGCTACTAGAATCTGCTGTGGAAGAGAGCAGAGCTAAGACTCCTGCCCCCTGACCATTCTTAGTTCACTATAACATTAGCCATTGGGCCCATCTCTGGGCAGTTCGGAGAGTGAAGCT

Ensembl | nº de acceso | ratón

ENSMUSG00000022018

Nº de acceso NCBI

NM_025427

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... 1190002H23Rik(66214)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

ACTRIMS-ECTRIMS MSBoston 2014: Poster Sessions 2.
Multiple sclerosis (Houndmills, Basingstoke, England), 20(1 Suppl), 285-496 (2014-09-11)
Ran Xu et al.
Molecular and cellular biochemistry, 394(1-2), 109-118 (2014-05-17)
Response gene to complement 32 (RGC32) is a novel protein originally identified as a cell cycle activator and has been demonstrated to be overexpressed in a variety of human malignancies, including lung cancer. However, the potential role of RGC32 in
Peng Zhao et al.
Cellular & molecular immunology, 12(6), 692-699 (2014-11-25)
Response gene to complement 32 (RGC-32) is a cell cycle regulator involved in the proliferation, differentiation and migration of cells and has also been implicated in angiogenesis. Here we show that RGC-32 expression in macrophages is induced by IL-4 and

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico