Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU071921

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Stat1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTGACGACCCTAAGCGAACTGGATACATCAAGACTGAGTTGATTTCTGTGTCTGAAGTCCACCCTTCTAGACTTCAGACCACAGACAACCTGCTTCCCATGTCTCCAGAGGAGTTTGATGAGATGTCCCGGATAGTGGGCCCCGAATTTGACAGTGTGATGAGCACAGTATAAACACGAATTTCTCTCTGGCGACATTTTTTTCCCATCTGTGATTCCTTCCTGCTACTGTTCCTTCATATGCAGTATTTCTAGGGAAATGCAAGAAAGAAAGAGCATCACATTTGCTGAGCACTGCTGGTAGAAAGTGGATATTTCTCTAATTAGAAACCTGTTACTCTGAAGGACTTCATGCATCTTACTGAAGGTGAAATGGAAAGTCACTTAACACAAAATGGATTTTGTAAACAAAGACCAAGAGATCCACCCAA

Ensembl | nº de acceso | ratón

ENSMUSG00000026104

Nº de acceso NCBI

NM_009283

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... STAT1(20846) , Stat1(20846)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
VPU
VOU
AUT
WIT
HES

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

6-Dehydrogingerdione restrains lipopolysaccharide-induced inflammatory responses in RAW 264.7 macrophages.
Huang SH, Lee CH, Wang HM, et al.
Journal of Agricultural and Food Chemistry, 62(37), 9171-9179 (2014)
Takashi Shimizu et al.
Science signaling, 14(667) (2021-01-28)
Pulmonary arterial hypertension (PAH) is a fatal disease characterized by excessive pulmonary vascular remodeling. However, despite advances in therapeutic strategies, patients with PAH bearing mutations in the bone morphogenetic protein receptor type 2 (BMPR2)-encoding gene present severe phenotypes and outcomes.
EunBin Kong et al.
Cell death and differentiation, 27(8), 2517-2530 (2020-03-05)
Autophagy is a cellular catabolic process that maintains intracellular homeostasis using lysosomal degradation systems. We demonstrate that inhibiting autophagy by depleting essential autophagy elongation proteins, Atg5 or Atg7, induces ISG15 expression through STING-mediated cytosolic dsDNA response. Genome stability is impaired
Huachen Gan et al.
Scientific reports, 5, 17916-17916 (2015-12-09)
Influenza A virus (IAV) targets airway epithelial cells and exploits the host cell machinery to replicate, causing respiratory illness in annual epidemics and pandemics of variable severity. The high rate of antigenic drift (viral mutation) and the putative antigenic shift
Shunsuke Fukuyo et al.
Rheumatology (Oxford, England), 53(7), 1282-1290 (2014-03-07)
The mechanisms of ectopic calcification in inflammatory diseases are poorly understood. We investigated the effects of inflammatory cytokines on the mechanisms of calcification in human adipose tissue-derived mesenchymal stem cells (hADSCs). The effects of inflammatory cytokines were evaluated using hADSCs
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico