Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU067621

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Brd2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTTCCCCAGCTAGTCCTCCTGGGAGTCTTGAGCCAAAGGCAGCAAGGCTCCCTCCTATGCGCAGAGAGAGTGGCCGCCCAATCAAACCCCCACGAAAAGACTTGCCTGACTCGCAACAGCAACACCAGAGCTCTAAGAAAGGGAAGCTGTCAGAGCAGTTAAAGCACTGCAACGGCATCCTGAAGGAACTGCTCTCAAAGAAGCACGCTGCCTACGCCTGGCCCTTCTATAAGCCAGTGGACGCTTCTGCTCTTGGCCTTCATGATTACCATGACATCATTAAACACCCCATGGACCTCAGCACTGTCAAGCGGAAGATGGAGAACCGTGACTACCGGGATGCACAGGAGTTTGCTGCTGATGTACGGCTTATGTTCTCCAACTGCTATAAGTACAATCCTCCAGACCACGATGTTGTG

Ensembl | nº de acceso | ratón

ENSMUSG00000024335

Nº de acceso NCBI

NM_001025387

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... BRD2(14312) , Brd2(14312)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

12 - Non Combustible Liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kun Zang et al.
PloS one, 8(10), e78536-e78536 (2013-11-07)
Bromodomain-containing protein 2 (Brd2) is a nuclear serine/threonine kinase involved in transcriptional regulation. In 3T3-L1 adipocytes, Brd2 normally co-represses PPARγ (peroxisome proliferator-activated receptor gamma) and inhibits adipogenesis. Here, we show that Brd2 over-expression in preadipocytes inhibits their differentiation into adipocytes
Chiara Pastori et al.
Epigenetics, 9(4), 611-620 (2014-02-06)
Epigenetic proteins have recently emerged as novel anticancer targets. Among these, bromodomain and extra terminal domain (BET) proteins recognize lysine-acetylated histones, thereby regulating gene expression. Newly described small molecules that inhibit BET proteins BRD2, BRD3, and BRD4 reduce proliferation of
Noelia Luna-Peláez et al.
Cell death & disease, 10(8), 548-548 (2019-07-20)
Mutations in NIPBL are the major cause of Cornelia de Lange Syndrome (CdLS). NIPBL is the cohesin-loading factor and has recently been associated with the BET (bromodomains and extra-terminal (ET) domain) proteins BRD2 and BRD4. Related to this, a CdLS-like
Chang Soon Choi et al.
Neurochemical research, 40(11), 2211-2219 (2015-09-10)
The post translational modification of lysine acetylation is a key mechanism that regulates chromatin structure. Epigenetic readers, such as the BET domains, are responsible for reading histone lysine acetylation which is a hallmark of open chromatin structure, further providing a

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico