Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EMU064851

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mapk3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACACGCAGCTGCAGTACATCGGCGAGGGCGCGTACGGCATGGTCAGCTCAGCTTATGACCACGTGCGCAAGACCAGAGTGGCCATCAAGAAGATCAGCCCCTTTGAGCATCAAACCTACTGTCAGCGCACGCTGAGGGAGATCCAGATCTTGCTGCGATTCCGCCATGAGAATGTTATAGGCATCCGAGACATCCTCAGAGCGCCCACCCTGGAAGCCATGAGAGATGTTTACATTGTTCAGGACCTCATGGAGACAGACCTGTACAAGCTGCTTAAAAGCCAGCAGCTGAGCAATGACCACATCTGCTACTTCCTCTACCAGATCCTCCGGGGCCTCAAGTATATACACTCAGCCAATGTGCTGCACCGGGACCTGAAGCCTTCCAATCTGCTTATCAACACCACCTGCGA

Ensembl | nº de acceso | ratón

ENSMUSG00000063065

Nº de acceso NCBI

NM_011952

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... MAPK3(26417) , Mapk3(26417)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Michael C Brown et al.
Journal of virology, 88(22), 13149-13160 (2014-09-05)
Translation machinery is a major recipient of the principal mitogenic signaling networks involving Raf-ERK1/2 and phosphoinositol 3-kinase (PI3K)-mechanistic target of rapamycin (mTOR). Picornavirus internal ribosomal entry site (IRES)-mediated translation and cytopathogenic effects are susceptible to the status of such signaling
Tabish Hasan Khan et al.
Journal of immunology (Baltimore, Md. : 1950), 193(7), 3644-3653 (2014-09-05)
CD40 plays dual immunoregulatory roles in Leishmania major infection and tumor regression. The functional duality emerges from CD40-induced reciprocal p38MAPK and ERK-1/2 phosphorylations. Because phosphotyrosine-based signaling in hematopoietic cells is regulated by the phosphotyrosine phosphatase SHP-1, which is not implied
Juan Zhao et al.
PloS one, 9(10), e108005-e108005 (2014-10-11)
MicroRNA-21 (miR-21) plays an important role in the pathogenesis and progression of liver fibrosis. Here, we determined the serum and hepatic content of miR-21 in patients with liver cirrhosis and rats with dimethylnitrosamine-induced hepatic cirrhosis and examined the effects of
Xiao-Wen Li et al.
Asian Pacific journal of tropical medicine, 8(11), 937-943 (2015-11-29)
To discuss the expression of mitogen-activated protein kinase 1 (MAPK1) in the cervical cancer and effect of MAPK1 gene silencing on epithelial-mesenchymal transition and invasion and metastasis. Immunohistochemistry, western blot and RT-PCR method were employed to detect the expression of
Si-Rui Ma et al.
Oncotarget, 6(11), 8807-8821 (2015-04-15)
Anterior gradient protein 2 (AGR2) is a novel biomarker with potential oncogenic role. We sought to investigate the diagnostic and prognostic role of AGR2 on head and neck squamous cell carcinoma (HNSCC) with an emphasis on its correlation of cancer
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico