Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU061651

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ccne1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GATGGAGGTGTGCGAAGTCTATAAGCTCCACAGAGAGACGTTCTACTTGGCACAGGACTTCTTTGATCGTTACATGGCATCACAACAGAATATCATAAAAACACTTTTACAGCTTATTGGGATTTCAGCCTTATTTATTGCTTCAAAACTTGAGGAAATCTACCCTCCAAAGTTGCACCAGTTTGCTTATGTTACAGATGGCGCTTGCTCCGGGGATGAAATTCTTACCATGGAATTGATGATGATGAAGGCCCTTAAGTGGCGTCTAAGCCCTCTGACCATTGTGTCCTGGCTGAATGTCTATGTCCAAGTGGCCTATGTCAACGACACGGGTGAGGTGCTGATGCCTCAGTACCCACAGCAGGTCTTCGTGCAGATCGCAGAGCTTCTAGACCTGTGCGTCC

Ensembl | nº de acceso | ratón

ENSMUSG00000002068

Nº de acceso NCBI

NM_007633

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... CCNE1(12447) , Ccne1(12447)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Zhiyuan Han et al.
Oncotarget, 6(15), 13149-13163 (2015-04-25)
Cyclin E1, encoded by the CCNE1 gene, promotes G1/S transition, chromosome instability, and oncogenesis. Here, we show that miR-497 and miR-34a target the 3'-UTR of CCNE1. miR-497 and miR-34a are downregulated in cancer cells and their ectopic expression inhibited cell
Xiaoyang Xu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 37(2), 419-431 (2015-09-01)
The accumulation of free cholesterol in atherosclerotic lesions has been well documented in both animals and humans. In studying the relevance of free cholesterol buildup in atherosclerosis, contradictory results have been generated, indicating that free cholesterol produces both pro- and
Ning-Ai Liu et al.
The Journal of clinical endocrinology and metabolism, 100(7), 2557-2564 (2015-05-06)
Cushing disease, due to pituitary corticotroph tumor ACTH hypersecretion, drives excess adrenal cortisol production with adverse morbidity and mortality. Loss of glucocorticoid negative feedback on the hypothalamic-pituitary-adrenal axis leads to autonomous transcription of the corticotroph precursor hormone proopiomelanocortin (POMC), consequent

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico