Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU057051

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Usp7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACCCTAAGGACCCTGCAAATTATATTCTCCATGCAGTCTTGGTTCACAGTGGAGATAATCATGGTGGACATTACGTGGTTTACCTAAACCCCAAAGGGGATGGCAAATGGTGTAAGTTCGATGATGACGTGGTATCCAGGTGTACTAAAGAAGAAGCCATTGAGCACAATTATGGGGGTCATGATGATGATCTGTCTGTTCGACACTGCACAAATGCCTATATGTTAGTGTACATCAGGGAATCAAAGCTAAGTGAAGTGTTACAAGCTGTCACCGACCATGATATTCCTCAGCAGTTGGTGGAACGATTGCAAGAAGAGAAAAGGATCGAGGCTCAGAAGCGGAAGGAGCGGCAGGAAGCCCATCTCTACATGCAAGTGCAGATAGTTGCAGAGGACCAGTTTTGTGGCCACCAAGGAAATGACATGTACGACGAGGAGAAAGTGAGGTACACTGTGTTCAAGGTTCTGAAGAACTCCTCCCTGGCCGAGTTTGTTCAGAGCCTCTCCCAG

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

12 - Non Combustible Liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Serena Giovinazzi et al.
Oncotarget, 5(11), 3728-3742 (2014-07-09)
USP7 (Ubiquitin Specific processing Protease-7) is a deubiquitinase which, over the past decade emerged as a critical regulator of cellular processes. Deregulation of USP7 activity has been linked to cancer, making USP7 inhibition an appealing anti-cancer strategy. The identification of
Seemana Bhattacharya et al.
The FEBS journal, 281(13), 3061-3078 (2014-05-16)
Tumor suppressor retinoblastoma-associated protein (Rb) is an important cell cycle regulator, arresting cells in early G1. It is commonly inactivated in cancers and its level is maintained during the cell cycle. Rb is regulated by various post-translational modifications such as
Key-Hwan Lim et al.
Scientific reports, 5, 12793-12793 (2015-08-05)
HAUSP (herpes virus-associated ubiquitin specific protease, known as ubiquitin specific protease 7), one of DUBs, regulates the dynamics of the p53 and Mdm2 network in response to DNA damage by deubiquitinating both p53 and its E3 ubiquitin ligase, Mdm2. Its

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico