Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU052671

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Msi1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTTTCGGCTTCGTCACTTTCATGGACCAGGCGGGGGTGGATAAAGTGCTGGCGCAATCGCGGCACGAGCTCGACTCCAAAACAATTGACCCCAAGGTGGCCTTTCCTCGAAGAGCACAGCCTAAGATGGTCACTCGGACGAAGAAGATCTTCGTGGGGGGGCTGTCTGTGAACACCACGGTGGAAGATGTGAAACACTATTTCGAGCAGTTCGGAAAGGTGGATGATGCCATGCTGATGTTCGACAAAACCACCAACAGGCACAGAGGGTTTGGATTTGTCACGTTTGAGAGCGAGGACATCGTAGAGAAAGTTTGTGAGATCCACTTCCATGAAATCAACAACAAAATGGTGGAATGCAAGAAAGCCCAGCCAAAGGAGGTGATGTCCCCGACAGGCTCAGCCCGGGGCAGGTCTCGGGTCATGCCCTACGGAATGGATGCCTTCATGCTGGGTAT

Ensembl | nº de acceso | ratón

ENSMUSG00000054256

Nº de acceso NCBI

NM_008629

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... MSI1(17690) , Msi1(17690)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

In-Sun Hong et al.
PloS one, 8(2), e56496-e56496 (2013-02-19)
Human umbilical cord blood (UCB)-derived mesenchymal stem cells (MSCs) are essential tools for regenerative medicine due to their capacity for self-renewal and multi-lineage differentiation. As MSCs are found in very small numbers in various tissues, in vitro cell expansion is
Mitzli X Velasco et al.
RNA (New York, N.Y.), 25(7), 768-782 (2019-04-21)
RNA-binding proteins (RBPs) and miRNAs are critical gene expression regulators that interact with one another in cooperative and antagonistic fashions. We identified Musashi1 (Msi1) and miR-137 as regulators of a molecular switch between self-renewal and differentiation. Msi1 and miR-137 have
Xiao-Yang Wang et al.
Molecular cancer, 9, 221-221 (2010-08-24)
Musashi1 (Msi1) is a conserved RNA-binding protein that regulates the Notch and Wnt pathways, and serves as a stem cell marker in the breast and other tissues. It is unknown how Msi1 relates to other breast cancer markers, whether it

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico