Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EMU052481

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Irf1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCAAAACCAAGAGGAAGCTGTGTGGAGATGTTAGCCCGGACACTTTCTCTGATGGACTCAGCAGCTCTACCCTACCTGATGACCACAGCAGTTACACCACTCAGGGCTACCTGGGTCAGGACTTGGATATGGAAAGGGACATAACTCCAGCACTGTCACCGTGTGTCGTCAGCAGCAGTCTCTCTGAGTGGCATATGCAGATGGACATTATACCAGATAGCACCACTGATCTGTATAACCTACAGGTGTCACCCATGCCTTCCACCTCCGAAGCCGCAACAGACGAGGATGAGGAAGGGAAGATAGCCGAAGACCTTATGAAGCTCTTTGAACAGTCTGAGTGGCAGCCGACACACATCGATGGCAAGGGATACTTGCTCAATGAGCCAGGGACCCAGCTCTCTTCTGTCTATGGAGACTTCAGCTGCAAAGAGGAACCAGAGATTGACAGCCC

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Min Guo et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 36(2), 599-610 (2015-05-23)
Atherosclerosis is widely recognized as a complex inflammatory disease involving pathogenic immune response of T cells and antigen-presenting cells (APCs) such as dendritic cells (DCs) and macrophages. Accumulating evidence has revealed that mature DCs play critical roles in the differentiation
Sugata Roy et al.
Journal of immunology (Baltimore, Md. : 1950), 194(12), 6035-6044 (2015-05-10)
Basic leucine zipper transcription factor Batf2 is poorly described, whereas Batf and Batf3 have been shown to play essential roles in dendritic cell, T cell, and B cell development and regulation. Batf2 was drastically induced in IFN-γ-activated classical macrophages (M1)

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico