Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU052411

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cdc42

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTGTTGGTGATGGTGCTGTTGGTAAAACATGTCTCCTGATATCCTACACAACAAACAAATTCCCATCGGAATATGTACCAACTGTTTTTGACAACTATGCAGTCACAGTTATGATTGGTGGAGAGCCATACACTCTTGGACTTTTTGATACTGCAGGGCAAGAGGATTATGACAGACTACGACCGCTAAGTTATCCACAGACAGATGTTTTTCTAGTATGTTTCTCAGTGGTCTCTCCATCCTCATTTGAAAATGTGAAAGAAAAGTGGGTGCCTGAGATAACTCACCACTGTCCAAAGACTCCTTTCTTGCTTGTTGGGACCCAAATTGATCTCAGAGATGACCCCTCTACTATTGAGAAACTTGCCAAGAACAAACAGAAGCCTATTACTCCAGAGACTGCTGAAAAGCTGGCGCGGGATCTGAAGGCTGTCAAGTATGTGGAGTGCTCCGC

Ensembl | nº de acceso | ratón

ENSMUSG00000006699

Nº de acceso NCBI

NM_009861

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... CDC42(12540) , Cdc42(12540)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
ZLU
AGU
LDU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Laurent Pieuchot et al.
Nature communications, 9(1), 3995-3995 (2018-09-30)
Cells have evolved multiple mechanisms to apprehend and adapt finely to their environment. Here we report a new cellular ability, which we term "curvotaxis" that enables the cells to respond to cell-scale curvature variations, a ubiquitous trait of cellular biotopes.
Shayoni Ray et al.
Molecular biology of the cell, 25(16), 2393-2407 (2014-06-27)
Coordinated actin microfilament and microtubule dynamics is required for salivary gland development, although the mechanisms by which they contribute to branching morphogenesis are not defined. Because LIM kinase (LIMK) regulates both actin and microtubule organization, we investigated the role of
Tilman D Rachner et al.
Breast cancer research : BCR, 16(1), R20-R20 (2014-02-18)
Amino-bisphosphonates and statins inhibit the mevalonate pathway, and may exert anti-tumor effects. The Wnt inhibitor dickkopf-1 (DKK-1) promotes osteolytic bone lesions by inhibiting osteoblast functions and has been implicated as an adverse marker in multiple cancers. We assessed the effects

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico