Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU050951

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ehmt2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCCTATGTGGTCAGCTCAGTATCCGATGCTGGTATGACAAGGACGGGCGGCTGCTCCAGGAGTTTAACAAGATCGAGCCCCCCCTGATCTTTGAGTGTAACCAGGCATGCTCCTGCTGGAGAAGCTGCAAGAACCGCGTGGTGCAGAGCGGCATCAAGGTACGGCTGCAGCTCTACCGGACTGCCAAGATGGGCTGGGGGGTCCGAGCCTTGCAGACCATCCCCCAGGGCACGTTCATCTGCGAGTATGTAGGAGAGCTGATCTCTGATGCCGAGGCTGATGTGAGAGAGGATGATTCTTACCTCTTCGATTTAGATAACAAGGATGGCGAGGTTTACTGCATTGATGCCCGTTACTATGGCAACATCAGCCGATTCATTAACCACCTGTGTGACCCCAACATCATCCCTGTCCGGGTTTTCATGCTGCACCAAGA

Ensembl | nº de acceso | ratón

ENSMUSG00000013787

Nº de acceso NCBI

NM_145830

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... EHMT2(110147) , Ehmt2(110147)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yize Li et al.
Advanced science (Weinheim, Baden-Wurttemberg, Germany), 7(13), 1902402-1902402 (2020-07-17)
Nerve injury-induced change in gene expression in primary sensory neurons of dorsal root ganglion (DRG) is critical for neuropathic pain genesis. N6-methyladenosine (m6A) modification of RNA represents an additional layer of gene regulation. Here, it is reported that peripheral nerve
Shuli Liu et al.
Oncotarget, 6(9), 6887-6901 (2015-03-10)
Head and neck squamous cell carcinoma (HNSCC) is a particularly aggressive cancer with poor prognosis, largely due to lymph node metastasis and local recurrence. Emerging evidence suggests that epithelial-to-mesenchymal transition (EMT) is important for cancer metastasis, and correlated with increased
Kee-Beom Kim et al.
Nucleic acids research, 43(7), 3509-3523 (2015-03-15)
Histone H3K9 methyltransferase (HMTase) G9a-mediated transcriptional repression is a major epigenetic silencing mechanism. UHRF1 (ubiquitin-like with PHD and ring finger domains 1) binds to hemimethylated DNA and plays an essential role in the maintenance of DNA methylation. Here, we provide

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico