Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU050071

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ptpn11

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGCTGGCTGAGACCACAGATAAAGTCAAGCAGGGCTTTTGGGAAGAGTTTGAGACGCTCCAGCAACAGGAATGCAAACTTCTCTATAGCCGAAAAGAAGGACAGAGACAAGAAAATAAAAACAAAAACAGATACAAAAACATCCTGCCCTTTGATCATACCAGGGTCGTTCTGCATGATGGGGATCCCAATGAGCCTGTTTCTGATTACATTAATGCAAACATCATCATGCCTGAGTTTGAGACCAAGTGCAACAATTCCAAACCCAAAAAGAGTTACATTGCCACTCAAGGCTGCCTGCAGAACACGGTGAATGACTTCTGGCGGATGGTGTTCCAGGAGAACTCTCGAGTCATTGTCATGACCACAAAGGAAGTGGAGAGAGGGAAGAGCAAATGTGTCAAGTACTGGCCTGATGAGTATGCGCTCAA

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Toru Mitsumori et al.
Experimental hematology, 42(9), 783-792 (2014-05-28)
The hypoxic microenvironment of the bone marrow, known as the hypoxic niche, supports hematopoietic stem cell quiescence and maintains long-term repopulation activity. Hypoxia also affects the expansion of progenitor cells and enhances erythropoiesis and megakaryopoiesis. In contrast to the known
Rong-Ping Zhou et al.
Molecular medicine reports, 11(6), 4489-4495 (2015-01-31)
Chlorogenic acid (CGA) exhibits various biological properties, including the inhibition of oxidation, obesity, apoptosis and tumorigenesis. CGA is also able to promote cell survival and proliferation. The aim of the present study was to determine the effects and underlying molecular
Hsueh-Chun Wang et al.
BMC cancer, 14, 442-442 (2014-06-17)
Tumor invasion and metastasis represent a major unsolved problem in cancer pathogenesis. Recent studies have indicated the involvement of Src-homology 2 domain-containing tyrosine phosphatase 2 (SHP2) in multiple malignancies; however, the role of SHP2 in oral cancer progression has yet
K S Siveen et al.
British journal of cancer, 111(7), 1327-1337 (2014-08-08)
Constitutive activation of signal transducer and activator of transcription signalling 3 (STAT3) has been linked with survival, proliferation and angiogenesis in a wide variety of malignancies including hepatocellular carcinoma (HCC). We evaluated the effect of lupeol on STAT3 signalling cascade

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico