Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EMU046811

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Atox1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTGTGCCGCGTCAGTCATGCCGAAGCACGAGTTCTCCGTGGACATGACCTGTGAGGGCTGTGCTGAAGCCGTCTCCAGAGTCCTCAACAAGCTGGGAGGAGTGGAGTTCAACATTGACCTGCCCAACAAGAAGGTCTGCATCGACTCTGAGCACAGCTCAGACACCCTGCTGGCAACCCTCAACAAAACAGGAAAGGCTGTTTCCTACCTTGGCCCCAAGTAGCCAGGACCTGGGCGAGTCCTTCCGGATATAAACTGAAGAGGCAGGCTGTTGATCTGGTCTCCCCGGCAGATCTGGAACACCAACTGCTCAGTCCAGTCCAGCCCAGCCATGGAGTTCCTGCCCAGACAGGCCTTCCCCGCTGGCTCCCTGCAAGCTTCCATGTAATAAAGTCAAGCTGAGTTT

Ensembl | nº de acceso | ratón

ENSMUSG00000018585

Nº de acceso NCBI

NM_009720

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... ATOX1(11927) , Atox1(11927)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Huawei Cai et al.
Oncology reports, 30(1), 269-275 (2013-04-30)
Copper is required for cell proliferation and tumor angiogenesis. Cellular copper metabolism is regulated by a network of copper transporters and chaperones. Antioxidant-1 (ATOX1) is a cytosolic copper chaperone important for intracellular copper transport, which plays a role in the
Arundhati Jana et al.
PloS one, 15(1), e0227916-e0227916 (2020-01-22)
Colorectal cancer remains a deadly cancer due to metastatic disease. To understand the molecular mechanisms of metastasis in colon cancer, we investigated whether the copper chaperone antioxidant-1 (Atox1) protein plays a role in this process. Recent findings indicate that Atox1
Gin-Fu Chen et al.
Scientific reports, 5, 14780-14780 (2015-10-07)
Copper (Cu), an essential micronutrient, plays a fundamental role in inflammation and angiogenesis; however, its precise mechanism remains undefined. Here we uncover a novel role of Cu transport protein Antioxidant-1 (Atox1), which is originally appreciated as a Cu chaperone and
Edward A Ratovitski
Current pharmaceutical biotechnology, 16(9), 832-850 (2015-06-20)
MicroRNAs, whose transcription is regulated by members of the tumor protein p53 family, modulate the expression of numerous metabolic enzymes, significantly altering tumor cell response to chemotherapeutic treatments. The role for ΔNp63α-regulated microRNAs in regulation of cell cycle arrest, apoptosis

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico