Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EMU039321

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Pak2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGGGCAAGAGGTTGCTATCAAGCAGATTAATTTACAGAAACAACCAAAGAAGGAATTGATCATTAATGAAATTCTGGTGATGAAAGAGTTAAAGAATCCCAACATAGTTAACTTCTTGGACAGTTACCTGGTAGGAGATGAGTTGTTTGTGGTAATGGAGTACCTCGCTGGTGGGTCCCTCACTGATGTTGTAACAGAAACCTGCATGGACGAAGCGCAGATTGCCGCCGTGTGCAGAGAGTGTTTACAGGCGTTGGAGTTTTTACATGCTAATCAAGTGATCCACAGAGACATCAAAAGTGACAATGTGCTTTTGGGAATGGAAGGCTCAGTTAAACTTACTGACTTCGGCTTCTGTGCCCAGATCACTCCTGAACAGAGCAAACGCAGTACTATGGTTGGAACACCGTACTGGATGGCACCAGAGGTGGTGACACGGAAAGCCTATGGTCCCAAAGTTGACATATGGTCTCTGGGCATCATGGCTATCGAGATGGTTGAAGGAGAGC

Ensembl | nº de acceso | ratón

ENSMUSG00000022781

Nº de acceso NCBI

NM_177326

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... PAK2(224105) , Pak2(224105)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ting Shuang et al.
FEBS letters, 589(20 Pt B), 3154-3164 (2015-09-13)
MiR-134 has been reported to have a role in the development and progression of various cancers. In this study, we found that miR-134 expression was significantly decreased in chemo-resistant serous epithelial ovarian cancer (EOC) patients. Over-expression of miR-134 enhanced the
Elizabeth Flate et al.
International journal of oncology, 45(4), 1401-1411 (2014-07-23)
The interaction between tumor cells and extracellular matrix (ECM) proteins influences cell migration and the invasive behavior of cancer cells. In this study, we provide experimental evidence that collagen I and fibronectin affect ovarian cancer cell migration. In vitro wound healing assays
Anna E Dart et al.
The Journal of cell biology, 211(4), 863-879 (2015-11-26)
P21-activated kinase 4 (PAK4) is a Cdc42 effector protein thought to regulate cell adhesion disassembly in a kinase-dependent manner. We found that PAK4 expression is significantly higher in high-grade human breast cancer patient samples, whereas depletion of PAK4 modifies cell

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico