Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EMU036901

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Scarb1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCAAATTTGGCCTGTTTGTTGGGATGAACAACTCGAATTCTGGGGTCTTCACTGTCTTCACGGGCGTCCAGAATTTCAGCAGGATCCATCTGGTGGACAAATGGAACGGACTCAGCAAGATCGATTATTGGCATTCAGAGCAGTGTAACATGATCAATGGGACTTCCGGGCAGATGTGGGCACCCTTCATGACACCCGAATCCTCGCTGGAATTCTTCAGCCCGGAGGCATGCAGGTCCATGAAGCTGACCTACAACGAATCAAGGGTGTTTGAAGGCATTCCCACGTATCGCTTCACGGCCCCCGATACTCTGTTTGCCAACGGGTCCGTCTACCCACCCAACGAAGGCTTCTGCCCATGCCGAGAGTCTGGCATTCAGAATGTCAGCACCTGCAGGTTTGGTGCGCCTCTGTTTCTCTCCCACCCCCACTTTTACAACGCCGACCCTGTGTTGTCAGAAGCTGTTCTTGGTCTGAACCCTAACCCAAAGGAGC

Ensembl | nº de acceso | ratón

ENSMUSG00000037936

Nº de acceso NCBI

NM_016741

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... SCARB1(20778) , Scarb1(20778)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Laeticia Lichtenstein et al.
Cardiovascular research, 106(2), 314-323 (2015-03-15)
High-density lipoproteins (HDLs) protect against atherosclerosis mainly due to their function in hepatobiliary reverse cholesterol transport (RCT). This is a process whereby excess cholesterol from peripheral tissues is transported by HDL particles to the liver for further metabolism and biliary
Georgia Schäfer et al.
PloS one, 4(12), e8448-e8448 (2009-12-31)
The interaction between Mycobacterium tuberculosis (Mtb) and host cells is complex and far from being understood. The role of the different receptor(s) implicated in the recognition of Mtb in particular remains poorly defined, and those that have been found to
Pin Yue et al.
PloS one, 5(3), e9906-e9906 (2010-04-03)
CD36 facilitates oxidized low density lipoprotein uptake and is implicated in development of atherosclerotic lesions. CD36 also binds unmodified high and very low density lipoproteins (HDL, VLDL) but its role in the metabolism of these particles is unclear. Several polymorphisms
Xia Chu et al.
Molecular nutrition & food research, 59(8), 1491-1503 (2015-05-07)
Ursolic acid (UA) is a triterpenoid compound with multifold biological functions. Our previous studies have reported that UA protects against high-fat diet-induced obesity and improves insulin resistance (IR). However, the potential mechanisms are still undefined. Free fatty acid (FFA) metabolism
Xiaoxiao Yang et al.
The Journal of biological chemistry, 290(36), 21788-21799 (2015-07-19)
The glutathione (GSH)-dependent antioxidant system has been demonstrated to inhibit atherosclerosis. Macrophage CD36 uptakes oxidized low density lipoprotein (oxLDL) thereby facilitating foam cell formation and development of atherosclerosis. It remains unknown if GSH can influence macrophage CD36 expression and cellular
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico