Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU026991

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mdm2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGTTTGGAGTCCCGAGTTTCTCTGTGAAGGAGCACAGGAAAATATATGCAATGATCTACAGAAATTTAGTGGCTGTAAGTCAGCAAGACTCTGGCACATCGCTGAGTGAGAGCAGACGTCAGCCTGAAGGTGGGAGTGATCTGAAGGATCCTTTGCAAGCGCCACCAGAAGAGAAACCTTCATCTTCTGATTTAATTTCTAGACTGTCTACCTCATCTAGAAGGAGATCCATTAGTGAGACAGAAGAGAACACAGATGAGCTACCTGGGGAGCGGCACCGGAAGCGCCGCAGGTCCCTGTCCTTTGATCCGAGCCTGGGTCTGTGTGAGCTGAGGGAGATGTGCAGCGGCGGCAGCAGCAGCAGTAGCAGCAGCAGCAGCGAGTCCACAGAGACGCCCTCGCATCAGGATCTTGACGATGGCGTAAGTGAGCATTCTGGTGATTGCCTGGATCAGGAT

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shaneabbas Raza et al.
Molecular and cellular biochemistry, 410(1-2), 187-195 (2015-09-10)
Estrogen is synthesized from cholesterol and high cholesterol levels are suggested to be associated with increased risk of estrogen receptor(ER)-positive breast cancer. The cholesterol metabolite 27-hydroxycholesterol (27-OHC) was recently identified as a selective estrogen receptor modulator (SERM) and may therefore
Eva Slabáková et al.
Oncotarget, 6(34), 36156-36171 (2015-09-30)
Plasticity of cancer cells, manifested by transitions between epithelial and mesenchymal phenotypes, represents a challenging issue in the treatment of neoplasias. Both epithelial-mesenchymal transition (EMT) and mesenchymal-epithelial transition (MET) are implicated in the processes of metastasis formation and acquisition of
Seemana Bhattacharya et al.
The FEBS journal, 281(13), 3061-3078 (2014-05-16)
Tumor suppressor retinoblastoma-associated protein (Rb) is an important cell cycle regulator, arresting cells in early G1. It is commonly inactivated in cancers and its level is maintained during the cell cycle. Rb is regulated by various post-translational modifications such as
Hong Zhu et al.
Oncotarget, 6(5), 3254-3267 (2014-09-17)
Adriamycin, a widely used anthracycline antibiotic in multiple chemotherapy regimens, has been challenged by the cardiotoxicity leading to fatal congestive heart failure in the worst condition. The present study demonstrated that Dihydromyricetin, a natural product extracted from ampelopsis grossedentat, exerted
Jiang-Jiang Qin et al.
Oncotarget, 6(5), 2623-2640 (2015-03-05)
The MDM2 oncogene has been suggested as a molecular target for treating human cancers, including breast cancer. Most MDM2 inhibitors under development are targeting the MDM2-p53 binding, and have little or no effects on cancers without functional p53, such as

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico