Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EMU026621

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cyr61

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGACCCGGATCTGTGAAGTGCGTCCTTGTGGACAACCAGTGTACAGCAGCCTAAAAAAGGGCAAGAAATGCAGCAAGACCAAGAAATCCCCAGAACCAGTCAGATTTACTTATGCAGGATGCTCCAGTGTCAAGAAATACCGGCCCAAATACTGCGGCTCCTGCGTAGATGGCCGGTGCTGCACACCTCTGCAGACCAGAACTGTGAAGATGCGGTTCCGATGCGAAGATGGAGAGATGTTTTCCAAGAATGTCATGATGATCCAGTCCTGCAAATGTAACTACAACTGCCCGCATCCCAACGAGGCATCGTTCCGACTGTACAGCCTATTCAATGACATCCACAAGTTCAGGGACTAAGTGCCTCCAGGGTTCCTAGTGTGGGCTGGACAGAGGAGAAGCGCAAGCATCATGGAGACGTGGGTGGGCGGAGGATGAATGGTGCCTTGCTCATTCTT

Ensembl | nº de acceso | ratón

ENSMUSG00000028195

Nº de acceso NCBI

NM_010516

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... CYR61(16007) , Cyr61(16007)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hemabindu Chintala et al.
Development (Cambridge, England), 142(13), 2364-2374 (2015-05-24)
Physiological angiogenesis depends on the highly coordinated actions of multiple angiogenic regulators. CCN1 is a secreted cysteine-rich and integrin-binding matricellular protein required for proper cardiovascular development. However, our understanding of the cellular origins and activities of this molecule is incomplete.
Yu Di et al.
Drug design, development and therapy, 9, 2463-2473 (2015-05-23)
CCN1 (also called Cyr 61) is an extracellular matrix signaling molecule that has been implicated in neovascularization through its interactions with several endothelial integrin receptors. The roles of vascular endothelial growth factor (VEGF) in angiogenesis are well described. The aim

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico