Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EMU020501

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Bag3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGCAATTGATGTCCCAGGTCAAGTACAAGTCTATGAACTCCAGCCCAGCAACCTTGAGGCCGAGCAGCCACTCCAGGAAATCATGGGTGCCGTGGTAGCCGACAAGGATGAGAAAGGTCCTGAAAACAAAGATCCACAAACTGAAAGCCAACAGCTAGAAGCCAAAGCAGCCACACCTCCAAATCCCAGCAACCCAGCAGACTCAGCTGGCAACCTGGTGGCTCCCTAGTGTCCCCTGGGACCATGCTGTAGAGACTTTTAAGTTGCATGCACTGCGGGACTTGCAGTCAGCTGGCTGCCATTATTCATAGCCACTTGGTATGCAGTAACTTGGGGTGGAGGTAAAACACTAACAAAGGGGGCTTTTCTTCCATAGTCTATTCTGTATAAATAATAAGTTGCCTGTTCCAGAAGTCTAACCCTAACCCCTCTGGTTGTCTGG

Ensembl | nº de acceso | ratón

ENSMUSG00000030847

Nº de acceso NCBI

NM_013863

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... BAG3(29810) , Bag3(29810)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Georg Karpel-Massler et al.
Oncotarget, 6(16), 14507-14521 (2015-05-27)
Despite great efforts taken to advance therapeutic measures for patients with glioblastoma, the clinical prognosis remains grim. The antiapoptotic Bcl-2 family protein Mcl-1 is overexpressed in glioblastoma and represents an important resistance factor to the BH-3 mimetic ABT263. In this
Georg Karpel-Massler et al.
Oncotarget, 6(34), 36456-36471 (2015-10-17)
Glioblastoma is the most frequent primary brain tumor in adults. Current therapeutic options are sparse and the prognosis of patients suffering from this disease is grim. Abundance in intratumoral heterogeneity among different deregulated signaling pathways is a hallmark of glioblastoma
Young-Hee Jin et al.
Biochemical and biophysical research communications, 464(2), 561-567 (2015-07-15)
Bcl2-associated athoanogene (BAG) 3 is a member of the co-chaperone BAG family. It is induced by stressful stimuli such as heat shock and heavy metals, and it regulates cellular adaptive responses against stressful conditions. In this study, we identified a

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico