Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU018341

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ephb2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGGCTTAGTCTTCCTCATCGCTGTGGTCGTCATTGCCATCGTATGTAACAGACGGGGGTTTGAGCGTGCCGACTCAGAGTACACGGACAAGCTACAACACTACACCAGCGGACACATGACCCCAGGCATGAAGATCTATATAGACCCTTTCACCTATGAAGATCCTAATGAGGCAGTGCGGGAGTTTGCCAAGGAAATTGACATCTCCTGTGTCAAGATTGAGCAGGTGATCGGAGCAGGGGAATTTGGTGAGGTCTGCAGTGGCCATTTGAAGCTGCCAGGCAAGAGAGAGATCTTTGTAGCCATCAAGACCCTCAAGTCAGGATACACGGAGAAACAGCGCCGGGACTTCCTGAGTGAGGCATCCATCATGGGCCAGTTCGACCACCCCAATGTCATCCATCTGGAAGGGGTTGTCACCAAGAGCACACCTGTC

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiuqing Li et al.
PloS one, 9(8), e105326-e105326 (2014-08-26)
Effective treatment of transitional cell carcinoma (TCC) of the bladder requires early diagnosis. Identifying novel molecular markers in TCC would guide the development of diagnostic and therapeutic targets. Ephrins mediate signals via tyrosine kinase activity that modulates diverse physiologic and
Walaiporn Khansaard et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(10), 10031-10041 (2014-07-12)
The activation of Ephrin (Eph) receptors, the largest tyrosine kinase families of cell surface receptor, has recently been addressed in human cholangiocarcinoma (CCA). Therefore, the present study aimed to investigate the role of Eph receptors and its ligands in CCA.
Young Hyun Jung et al.
Biochimica et biophysica acta, 1853(8), 1905-1917 (2015-05-13)
The role of unsaturated fatty acids (UFAs) is essential for determining stem cell functions. Eph/Ephrin interactions are important for regulation of stem cell fate and localization within their niche, which is significant for a wide range of stem cell behavior.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico