Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU015391

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Map2k5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTGGATGTGATAGGCCAGGTTCTGCCTGAAGCGACGACGACAGCGTTTGAATATGAAGATGAAGATGGTGATAGGATTACAGTAAGAAGCGATGAAGAGATGAAGGCAATGCTGTCCTACTATTATTCCACAGTAATGGAACAGCAAGTAAATGGCCAGCTAATAGAGCCGCTGCAGATATTTCCAAGAGCCTGCAAGCCTCCCGGGGAACGGAACATACATGGCCTGAAGGTGAATACACGGGCTGGGCCATCTCAACACACCAGCCCTGTGGTCTCAGATTCGCTTCCAAGCAATAGCTTGAAGAAGTCCTCAGCTGAACTGAGAAAGATACTGGCCAACGGCCAGATGAATGAACAAGACATACGGTATCGAGACACCCTTGGTCATGGCAACGGAGGCACAGTCTACAAAGCACATCATGTCCCA

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shigeru Amano et al.
PloS one, 10(4), e0125054-e0125054 (2015-04-18)
The MEK/ERK pathways are critical for controlling cell proliferation and differentiation. In this study, we show that the MEK5/ERK5 pathway participates in osteoclast differentiation. ERK5 was activated by M-CSF, which is one of the essential factors in osteoclast differentiation. Inhibition
Shoichi Kaneshiro et al.
Biochemical and biophysical research communications, 463(3), 241-247 (2015-05-23)
Extracellular signal-regulated kinase 5 (ERK5) is a member of the mitogen-activated protein kinase (MAPK) family and is activated by its upstream kinase, MAPK kinase 5 (MEK5), which is a member of the MEK family. Although the role of MEK5 has

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico