Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU007401

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Atg4b

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GACGCAGCCACTTTGACATATGATACTCTCCGGTTTGCTGAATTTGAAGATTTCCCTGAGACCTCAGAGCCTGTTTGGATTCTGGGCAGAAAATACAGCATTTTCACAGAGAAGGACGAAATCTTGTCTGATGTTGCATCCAGACTTTGGTTTACATACAGGAGAAACTTTCCAGCTATTGGGGGAACTGGCCCTACTTCAGACACAGGCTGGGGTTGCATGCTTCGGTGTGGACAGATGATCTTTGCCCAGGCCCTGGTATGCCGGCACTTAGGTCGAGATTGGAGGTGGACTCAGCGGAAGAGGCAGCCTGACAGCTACTTTAATGTCCTCAATGCTTTCCTCGACAGGAAGGACAGCTACTATTCCATCCATCAGATAGCGCAAATGGGAGTTGGCGAAGGCAAGTCTA

Ensembl | nº de acceso | ratón

ENSMUSG00000026280

Nº de acceso NCBI

NM_174874

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... ATG4B(66615) , Atg4b(66615)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Katharina Rothe et al.
Blood, 123(23), 3622-3634 (2014-04-24)
Previous studies demonstrated that imatinib mesylate (IM) induces autophagy in chronic myeloid leukemia (CML) and that this process is critical to cell survival upon therapy. However, it is not known if the autophagic process differs at basal levels between CML
Pei-Feng Liu et al.
Autophagy, 10(8), 1454-1465 (2014-07-06)
Autophagy is reported to suppress tumor proliferation, whereas deficiency of autophagy is associated with tumorigenesis. ATG4B is a deubiquitin-like protease that plays dual roles in the core machinery of autophagy; however, little is known about the role of ATG4B on

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico